AAV1.NT3 gene therapy mitigates the severity of autoimmune encephalomyelitis in the mouse model for multiple sclerosis

Multiple sclerosis (MS) is characterized by immune dysregulation, which results in the focal infiltration of the CNS by immune cells, triggering demyelination, secondary axonal damage, and neurodegeneration [1,2,3,4,5]. MS affects ~1 million people in the United States [6]. About 85–90% of MS patients develop a relapsing-remitting form of the disease, which then becomes a chronic, progressive, lifetime condition, known as secondary progressive MS, with irreversible accumulation of neurologic disability. A smaller number of MS patients (10–15%) follow a progressive clinical course from the onset of the disease, known as primary progressive MS. Detailed histopathological studies have now emphasized that the clinical and pathologic phenotype of disease course exists along a spectrum, with focal inflammatory lesions associated with relapses at one end, and neurodegeneration with progressive accumulation of disability at the other [5].

Immunopathogenesis of MS is highly complex, although a large body of evidence indicates that the disease is initiated by proinflammatory CD4⁺ T helper 1 (Th1) and Th17, which are reactive against CNS myelin proteins [7, 8]. While focal inflammatory lesions of the white matter are the hallmark of relapsing-remitting MS, the pathologic processes underlying progressive MS are more complex and include different mechanisms and pathways triggered by cascade of events that lead to neurodegeneration, amplified by pathogenic mechanisms related to brain aging and accumulated disease burden.  The major components of the process driving neurodegeneration include microglia activation, chronic oxidative injury, and accumulation of mitochondrial damage in axons [9]. Disease-modifying therapies alter the course of MS through suppression or modulation of immune function [1, 10]. A proposed major therapeutic strategy in MS is to block destructive immune effector cells while enhancing immunosuppressive regulatory cells [11]. Although good progress has been made against anti-inflammatory activity during the relapse phase, effective therapies against chronic progressive MS remains an unmet need, and accumulating evidence suggests that treatment of progressive MS should be based on a combination of anti-inflammatory, regenerative, and neuroprotective strategies [9].

Neurotrophin 3 (NT-3), like other neurotrophins, was initially identified because of its essential function in nervous system development, myelination, growth, axonal protection, and regeneration control [12,13,14,15,16]. However, broader effects of NT-3 are now recognized, extending to a wide range of cell types, including immune cells and participation in inflammatory responses. Studies suggest that NT-3 plays a critical role in the regulation or maintenance of the T helper cell 1 and 2 (Th1/Th2) balance through interaction with its receptor, TrkC, expressed by Th2 cells [17]. NT-3 acts as a trigger for IL-4 production in TrkC-expressing Th2 cells, affecting Dendritic cell (DC) maturation and inducing regulatory DC formation. Thus, the NT-3/TrkC system is thought to be involved in the induction or maintenance of Th2-dependent immunity. The efficacy of the immunomodulatory and anti-inflammatory properties of NT-3 was previously demonstrated in the spontaneous autoimmune peripheral polyneuropathy mouse model [18] for chronic inflammatory polyradiculopathy in humans, using the AAV1.NT-3 gene therapy approach [19,20,21,22,23]. This approach was developed due to the short half-life of NT3 peptide in serum, requiring repeated subcutaneous delivery [24]. In contrast, a gene therapy approach entails intramuscular (IM) delivery of the scAAV1.tMCK.NT-3 vector, providing a systemic effect following transduction of muscle to produce NT-3 protein, which is released into serum continuously, as detected by ELISA [18,19,20,21,22,23]. The treated SAAP mice showed increased hindlimb grip strength, correlating with improved compound muscle action potential, CMAP and increased remyelinated nerve fiber population [18]. In this model, we also showed decreased number of infiltrating CD3⁺ T cells, as well as reduced expression of tumor necrosis factor (TNF)-α and interleukin IL-1β, with an increase of IL-10 and FoxP3 in sciatic nerves, illustrating anti-inflammatory properties of NT-3. In addition, bone marrow-derived DCs, when challenged with bacterial lipopolysaccharide (LPS) in the presence of NT-3, showed significantly increased IL-10 secretion and decreased TNF-α, indicating that DCs gained ability to suppress an immune response [18]. The anti-inflammatory effect of NT-3 was previously shown in the experimental autoimmune encephalomyelitis (EAE) model through the creation of an anti-inflammatory cytokine milieu in the spinal cord by NT-3-transduced embryonic stem cell-derived microglia [25]. Moreover, NT-3 promotes oligodendrocyte precursor proliferation, survival, and differentiation, and myelin protein synthesis [26, 27]. Furthermore, NT-3 has significant capacity to provide neuroprotection and reduce astrogliosis [28], which is important in the formation of MS plaque. Therefore, success in neuroprotection and immunomodulation by NT-3 potentially fulfills the requirements necessary for the treatment of EAE and its clinical correlate chronic progressive MS. The studies we report here provide evidence that AAV1.NT-3 gene therapy is well positioned for suppressing immune reactions against CNS myelin, providing remyelination and axon protection to reverse/attenuate disease process in the EAE mouse model of chronic progressive MS.

Animals and EAE model Induction

All animal experiments were performed according to the guidelines approved by the Research Institute at Nationwide Children’s Hospital Animal Care and Use Committee, that operates in full accordance with the Animal Welfare Act and the Health Research Extension Act (IACUC approval number: AR21-00140). Male (n = 17) and female (n = 16) C57BL/6 mice, aged 8–12 weeks, obtained from the Jackson laboratory (Strain No.: 000664), were used in this study. Mice were immunized with synthetic myelin oligodendrocyte glycoprotein peptide (MOG_35-55, MEVGWYRSPFSRVVHLYRNGK, R&D Systems Catalog 2568/1) in complete Freund’s adjuvant (CFA) with Mycobacterium tuberculosis H37Ra (Fisher Scientific BD231141) to induce EAE. EAE was induced in six different times, and the number of mice for each induction varied from 4 to 8. For each mouse, 200 µg of MOG_35-55 peptides and 200 µg H37Ra were emulsified in CFA and bilaterally injected subcutaneously into the flanks, followed by intraperitoneal injection of 500 ng pertussis toxin (Bio-techne 3097). A second dose of pertussis toxin was administered 48 h after. Four mice were caged together, and, in each cage, 2 mice were randomly selected for NT-3 treatment (no specific randomization method was used). AAV1.tMCK.NT-3 was delivered via IM injection to the right gastrocnemius muscle (1.0 × 10¹¹ vg per mouse in Ringer’s lactate) at 21 days post EAE induction. Untreated cohort received Ringer’s lactate only. The assignment to the cohorts was not done until day 21 of EAE induction. Mice were closely monitored using a clinical scoring system as described previously [29, 30] (Table S1) starting on week 1, subjected to functional studies, and euthanized at 10 weeks post EAE transformation.

AAV.tMCK.NT-3 vector production and potency

The construction of self-complimentary (sc) AAV serotype 1 vector with muscle specific tMCK promoter was described previously [19]. The vector was produced in the Viral Vector Core at Nationwide Children’s Hospital, Columbus (Andelyn Biosciences). Aliquots of virus were stored at –80 °C until used. Blood samples were collected by cardiac puncture at the study endpoint and serum NT-3 level were detected by ELISA as previously reported [19].

Rotarod

Rotarod test was carried out weekly after EAE induction. Mice were acclimated to the rotarod apparatus (Columbus Instruments, Ohio, USA) before data collection. The test was performed by starting mice at 5-rpm, with a linear acceleration of 0.2 rpm/s. The average of the best two out of three runs were used for data analysis.

Grip strength

The bilateral simultaneous hind limb or forelimbs grip power of the mice were obtained using a grip strength meter (Chatillon Digital Meter, Model DFIS-2, Columbus Instruments, Columbus, OH). Bilateral strength was assessed by allowing the animals to grasp a platform followed by pulling the animal until it released the platform; the force measurements were recorded in three trials. Measurements was performed on the same day and time of each week.

Histological analysis

Separate groups of mice were included in the histopathological and molecular/immunological studies, because the histological studies require 10% formalin perfusion and cannot be used for molecular and immunological studies. Mice were anesthetized and perfused with 10% formalin prior to the dissection of the spinal cord and brain. Sections from paraffin-embedded spinal cord segments and brain were stained with Hematoxylin and Eosin (H&E) and Luxol Fast Blue (LFB) to assess inflammation and demyelination in the tissues. Serial sections from selected tissue blocks were stained with H&E and LFB-counter stained with eosin. The staining was performed by the Biopathology Center Processing and Banking Core at Nationwide Children’s Hospital. Additional mice were perfused with glutaraldehyde and spinal cord segments were processed for plastic embedding for high resolution microscopy, using established protocols in our lab.

Immunofluorescence staining (IF)

Paraffin embedded spinal cords were deparaffinized and cut cross-sectionally, at 5 µm thickness. The standard IF protocol from Abcam was followed: after heat-induced epitope retrieval using a microwave (performed by Histopathology Core), samples were blocked (10% normal serum and 1% BSA in TBS with 0.025% Triton X-100), incubated in one of the primary antibodies (Anti-Neurofilament 200 antibody, Sigma-Aldrich, N4142; GFAP, Invitrogen, 14-9892-82; IBA1, Invitrogen, PA5-27436), then incubated in a secondary antibody (Goat anti-Rabbit IgG, A-11011; Goat anti-Mouse IgG: A-11032; Invitrogen,). As region of interest for neurofilament staining, anterior corticospinal tracts of the lumbar segments, on both side of the anterior median fissure were imaged using a fluorescence microscope (Nikon, Ti2-E) at 90x magnification for analysis (n = 3 per cohort, 3 images per mouse). Mean area analyzed per image was 60,497.4 ± 1951.9 µm². Neurofilament-positive particles that correspond to axons were counted within a 70 µm wide subpial strips of white matter without bias, using automated Nikon NIS-Elements Imaging Software. Axon density data (count/mm²) were used for final comparison. For astrocyte (GFAP) and microglia (IBA1) staining (n = 3 per cohort for each staining), whole cross section the lumbar segments from spinal cord was imaged at 10x magnification. Nikon NIS-Elements Imaging Software was used to analyze the signal intensity and calculate the areas occupied by the positively stained cells.

RNA isolation and mRNA expression

Total RNA was extracted from fresh frozen brain and spinal cords using Mini RNeasy Plus Universal kit (Qiagen 73404). cDNA was synthesized using ProtoScript II First Strand cDNA Synthesis Kit (BioLabs E6560L). Primers (synthesized by IDT) for TNFα, IL1b and IL6 are from previous publication [31]. Tnfα (F- CCCTCACACTCAGATCATCTTCT, R-GCTACGACGTGGGCTACAG); IL1β (F-GCAACTGTTCCTGAACTCAACT, R-ATCTTTTGGGGTCCGTCAACT); IL6 (F-TAGTCCTTCCTACCCCAATTTCC, R-TTGGTCCTTAGCCACTCCTTC). Primer for myelin basic protein (mbp) and proteolipid protein (plp) were from PrimeTime from IDT. MBP (F-CCTCCGTAGCCAAATCCTG, R-ACCCAAGATGAAAACCCAGTA); PLP (F-ATGAGTTTAAGGACGGCGAAG, R-GTTCCAAATGACCTTCCACCT). All qPCR were performed using PowerUp SYBR Green Master Mix (ThermoFisher A25776) following manufacturer’s instructions. qPCR assays were performed in QuantStudio 6 Flex (Applied Biosystem). Target gene mRNA expression level were normalized to mouse Gapdh mRNA level and data were analyzed by ∆∆Ct method.

Dendrtic cell isolation and culture

The bone marrow cells were flushed from femur of EAE mice and cultured in cell culture dish with RPMI 1640 medium (ThermoFisher 11875119) containing 10% fetal bovine serum (ThermoFisher A5670701), glutamax (ThermoFisher 35050061), 10 ng/mL recombinant mouse granulocyte macrophages colony-stimulating factor (ThermoFisher PMC2016), 1% penicillin-streptomycin amphotericin B (ThermoFisher R01510) and 50 µM 2-mercaptoethanol (ThermoFisher 21985023). The medium was replaced every other day, and the cells were analyzed for the DC markers on days 8–10.

Analysis of regulatory T cells responses

To determine the role of T cell responses that is providing anti-inflammatory responses in the treated group versus control, regulatory T cells (Treg) proliferation and FoxP3 staining was evaluated in the spleen and lymph nodes in both cohorts. Briefly, animals were euthanized, spleen and mesenteric lymph nodes were harvested and homogenized by pressing through a Falcon 100 µm mash cell strainer. Cells were then incubated in 0.84% ammonium chloride buffer, followed a series of washes in RPMI 1640 to remove red blood cells. Cells were then resuspended in RPMI 1640 medium. Both splenocytes and lymphocytes were normalized to 1 × 10⁶ cell/100 µl, and cells were washed with PBS twice prior staining. Surface and transcription factor staining for T cells population were done per manufacturer’s instructions. The frequencies of surface markers CD3 PE-Cy7 (BioLegend 100219), CD4 APC (BioLegend 100515), CD25 PE/Dazzle 594 (BioLegend 101919), were stained for 30 min at 4°. After staining, cells were washed twice with FACS buffer. Cells then were fixed, and permeabilized by transcription factor buffer set (BD Biosciences 560409), before staining for transcription factor. The cells were stained then stained with FoxP3 AF-488 (BioLegend 320011) for 60 min at 4 °C. Cells were washed two times with permeabilization buffer, and once with FACS buffer, and resuspended in 400 µl of FACS buffer for flow cytometry analysis [32, 33].

Flow cytometry data analysis and visualization

The flow cytometry experiments were performed on a BD Fortessa (Kraken) at the Flow Core at Abigail Wexner Institute at Nationwide Children’s Hospital, Columbus. Quadric-gated as (CD3⁺CD4⁺CD5⁺FoxP3⁺) positive was used to differentiate the stained cell populations to specify T-reg population. Data analysis was finalized by FlowJo software v.10.8.1.

Statistics

Sample size was chosen based on our previous publication that included analogous experiments [18, 22]. All statistical analyses were performed in GraphPad Prism 9.0 software. Two-way ANOVA were performed to compare the means of two groups and Two tail Student t-test were performed where appropriate. The type of statistical analysis is given in the legends. p ≤ 0.05 was considered significant. Results were given as mean ± SEM in all experiments. No blinding method was used.

rAAV.NT-3 vector production and potency

The self-complimentary (sc) AAV1.tMCK.NT-3 design (Fig. S1A), and production followed previously described methods at Nationwide Children’s Hospital, Columbus [19]. The human NT-3 cDNA (GeneBank designation NTF3, referenced in this paper as NT-3) coding sequence was inserted under the control of muscle specific tMCK promoter and packaged using scAAV1 vector. scAAV1.tMCK.NT-3 at 1 × 10¹¹ vg was delivered to the gastrocnemius muscle of EAE induced mice, at 21 days post EAE induction (one week after the peak disease activity). Approximately 10 weeks after EAE induction, endpoint blood samples from terminally anesthetized EAE-induced and untreated mice were collected by cardiac puncture, and serum was assayed for NT-3 levels using a capture ELISA as previously reported [34]. The serum NT-3 in the AAV1.NT-3 treated mice were easily detected, whereas the levels in untreated cohort was below the assay’s detection threshold (Fig. S1B).

AAV1.NT-3 gene therapy ameliorates the clinical score and motor function in the EAE mouse

We successfully developed the EAE mouse model in our laboratory by immunization of C57BL/6 mice at 8–12 weeks of age with MOG_35-55, resulting in a chronic disease course, mimicking secondary progressive MS [35]. Mice were monitored three times a week using the standard 10-point clinical EAE scoring system [36]. EAE induction resulted in the expected peak of disease activity at 2 weeks; therefore, to assess treatment efficacy during the chronic phase, we chose to deliver NT-3 gene therapy 1 week after the peak disease activity, at the plateau phase of the disease progression. Clinical observations and functional studies showed that AAV1.NT-3 gene therapy ameliorated the clinical severity of EAE. The clinical score (higher clinical score indicates more severe symptoms) showed substantial improvement of treated mice compared to untreated mice with sex difference (Fig. 1A, B). As previously reported, we found that overall, the C57BL6 female mice were more susceptible to EAE induction compared to male counterparts [37]. During the initial peak disease activity for 3 weeks, there was no statistical difference in clinical scores between females and males and the EAE disease activity was comparable in both cohorts on day 21, however, male C57BL6 mice exhibited a less severe EAE after the initial peak activity in the following weeks during the disease course compared to females (see untreated female and male cohorts, Fig. 1A, B). After AAV1.NT-3 delivery on day 21, a significant and steady reduction from the clinical score of an average of 3 at day 15 to an average of 1.5 by day 30 and afterwards was observed, and the difference with the untreated cohort was statistically significant (Fig. 1A; p < 0.05, two-ways ANOVA). Similarly, a significant reduction/improvement in clinical score was observed in the treated male (Fig. 1B; p < 0.05, two-ways ANOVA).

Clinical scores in females (A) and males (B) from untreated (UT) and treated (NT-3) cohorts are shown. Higher clinical scores indicate more severe symptoms in the mice. Red line indicates the timepoint for AAV1.NT3 injection. Clinical scores between days 0–21 were not statistically different (ns) between cohorts. Grip strength (C, D) and rotarod (E, F) analyses from females and males respectively, with or without AAV1.NT-3 treatment. Data represents Mean ± SEM (Female cohort: n = 7 for untreated, and n = 9 for NT-3 treated; male cohort: n = 8 for untreated, and n = 9 for NT-3 treated cohorts). Two-way ANOVA, *p < 0.05.

Full size image

In agreement with improvements in the clinical scores, the treated EAE cohorts performed significantly better in grip strength (Fig. 1C, D) and rotarod tests (Fig. 1E, F), compared to untreated counterparts. To investigate the functional outcome of treatment in the EAE mice, grip strength for hind limb and rotarod functions were assessed weekly, starting from the day of AAV1.NT-3 injection (3 weeks post EAE induction). The grip strength force of AAV1.NT-3 treated females (Fig. 1C) stayed relatively stable over a six-week period (mean of 0.095 kg/m² at week 0 to 0.097 kg/m² at week 6). In contrast, we observed a decline of this function in the untreated female cohort by ~40% (from mean of 0.096 kg/m² to 0.058 kg/m² at week 6) within the same period, resulting in significantly higher force generation with treatment compared to the untreated counterparts (p < 0.05, two-way ANOVA) corresponding to a 40% higher endpoint performance (NT-3 treated: 0.097 ± 0.015 kg/m², n = 9 vs. UT: 0.058 ± 0.021 kg/m², n = 7). Males showed higher grip strength performance than female counterparts at the baseline (Fig. 1D). Similar to females, AAV1.NT-3 treatment in males resulted in an overall higher grip strength, starting 1 week post gene delivery compared to their untreated counterparts (p < 0.05, two-way ANOVA). The endpoint grip strength in the treated cohort was 54% greater than the UT cohort (NT-3 treated: 0.133 ± 0.008 kg/m², n = 9 vs UT: 0.09 ± 0.0178 kg/m² n = 8).

In rotarod testing, the treated female cohort (Fig. 1E) showed a significantly better performance with treatment (p < 0.05, two-way ANOVA) compared to UT cohort displaying a gradual decline over weeks, which resulted in a 48% higher performance with treatment at week 6 (38.8 ± 3.8 s vs. 20.2 ± 12.5 s, p < 0.05). Males, having less severe disease to begin with, also showed significantly better rotarod performance (Fig. 1F) compared to untreated counterparts (p < 0.05, two-way ANOVA). At endpoint, the AAV1.NT-3 treated cohort showed 49% increase (32.7 ± 3.9 s vs. 22.6 ± 2.2 s p < 0.001) in the rotarod time compared to the untreated counterparts. Collectively these data show that AAV1.NT-3 gene therapy in the EAE mouse results in significant improvements in clinical scores, with more strength in hindlimb grip testing, and better sensorimotor function on rotarod performance. It should be noted that NT-3 effect in both sexes is equal, normalization toward WT, and that the greater percent change in functional tests or clinical scores in females are related to the disease course, being more severe in females than males.

AAV1.NT-3 treated EAE mice show reduced inflammation, improved remyelination and axon protection in spinal cord

Hematoxylin & Eosin (H&E) stained cross sections from sacral, lumbar, mid, and upper thoracic spinal cord segments of untreated and treated mice (n = 4 per cohort) at 10 weeks post EAE induction were examined to assess inflammation. Multifocal perivascular subpial inflammation was present in all untreated mice at all four different levels of spinal cord segments examined as illustrated in Fig. 2A. In the AAV1.NT-3 treated group (Fig. 2B), only a few small areas of perivascular inflammation were observed in one out of four segments from two mice (Fig. 2C depicts WT for comparison). Luxor fast blue (LFB) stained paraffin sections from treated mice revealed preservation of the white matter long tracts at 7 weeks post treatment. (Fig. 2D, E) Figure 2F shows LFB-stained anterior corticospinal tract from WT for comparison. H&E and LFB-eosin counterstained serial-cut sections (Fig. 2G–I) further enhanced the visualization of demyelination (LFB) and the exact area of inflammation (H&E). Toluidine blue stained semi thick plastic sections from treated mice confirmed preservation of the white matter long tracts as illustrated in the descending anterolateral corticospinal tract (Fig. 3A, B). At high magnification plastic embedded sections, we observed preservation of myelinated fibers and abundance of thinly remyelinated axons with treatment (Fig. 3C–E). Moreover, quantitative immunofluorescence studies using an anti-neurofilament antibody as an axonal marker revealed that AAV1.NT-3 gene therapy significantly attenuated axon loss within the long tracts of the spinal cord (Fig. 4A–D). We also showed that improved remyelination and axon protection was clearly associated with NT-3-induced increases in the expression levels of myelin basic protein (MBP) and proteolipid protein (PLP) (Fig. 4E–H). Western Blot analyses on the same spinal cord samples showed increased MBP and PLP at the protein level with treatment, in agreement with the relative RNA expression levels (Fig. S2). This emphasizes the NT-3 effect as increase of remyelination and its protective effect on myelinated fiber integrity. Furthermore, we found reduced astrogliosis and microgliosis in the spinal cord from AAV1.NT-3 injected EAE mice compared to the untreated samples (Fig. S3) No pathologic changes were detected in the roots, sciatic nerves, or muscles from treated or untreated cohorts. Specifically, we found no inflammation in the vector-injected gastrocnemius muscle from the treated cohort at the endpoint (sampled from 3 females and 2 males, not shown). Collectively, these observations show that NT-3 gene therapy in this model resulted in a significantly decreased subpial inflammation and axon loss along with more thinly myelinated axons in the white matter of the spinal cord compared to untreated cohort.

H&E-stained representative cross sections illustrating ventral area from lumbar spinal cord of an untreated (UT) mouse (A) showing multifocal meningeal lymphocytic inflammation and from AAV1.NT-3 injected (NT-3) mouse (B) (arrows depict inflammation). Same area from wildtype (WT) is depicted in (C). LFB-stained paraffin sections of lumbar cord from UT (D) and NT-3 treated (E) mice, showing the presence of subpial demyelination (asterisks) in the UT-EAE mouse. WT is included for comparison (F). LFB-eosin counterstained section (G) shows reduced myelin staining in the descending anterolateral column (arrow) compared to ascending posterior white matter columns (arrowheads). A higher magnification of the area illustrating loss of myelin (H) harboring inflammatory cells in the H&E-stained serial section (I). Scale bars are 100 μm.

Full size image

One-µm thick plastic sections from an untreated mouse (A) showing subpial axon loss (asterisk) contrasting with a sample from NT-3 treated cohort (B), revealing preservation of the white matter long tracts in the descending anterolateral corticospinal tract at 7 weeks post treatment. Higher magnification image from an untreated mouse (C) showing subpial inflammation (star) and thinly remyelinated axons (arrows) which are in abundance in the NT-3 treated sample (D). Subpial area from ventral spinal cord of wild type (WT) is included for comparison (E). Scale bars are 50 μm for A and B, 10 μm for C, D and E.

Full size image

Representative immunofluorescence images of anterior corticospinal tracks from A untreated (UT), B NT-3 treated (NT-3), and C wild type (WT) mice. D Bar graph shows the number of anti-neurofilament antibody positive particles representing axons counted in a predetermined area of the white matter in the anterior corticospinal tracks (UT, 52,450.4 ± 4851.3; NT-3, 71,733.1 ± 1778.0 axons/mm²; student t-test, *p < 0.05; n = 3 for each cohort). Scale bar: 10 µm. The expression levels of E, F myelin basic protein (MBP) and G, H proteolipid protein (PLP) from UT and NT-3 treated cohorts. MBP and PLP expression increased significantly with treatment in both females and males (E–H, G). Female cohort: n = 4 for untreated, and n = 3 for NT-3 treated; male cohort: n = 6 for untreated, and n = 7 for NT-3 treated cohorts; student t-test, *p < 0.05. Data represents Mean ± SEM for all graphs.

Full size image

Immunomodulatory effect of NT-3 in EAE mice

Inflammatory markers decrease in AAV1.NT-3 treated EAE mice

The above-described clinical and histopathological improvements were associated with significant reductions in pro-inflammatory markers in the brain and spinal cord, compared to the treated cohort (Fig. 5). To characterize the immunomodulatory effect of treatment, RNA was isolated from fresh frozen brain and spinal cord tissue samples, and real time-PCR was performed to determine the expression level of inflammatory markers, including TNFα, IL1β and IL6. In the female cohort, the NT-3-treated group exhibited significantly reduced expression levels of all three markers in both brain and spinal cord compared to samples from untreated EAE mice (Fig. 5A–C). The male cohort, manifesting a milder disease, displayed less pronounced treatment efficacy. The AAV1.NT-3 gene delivery in the male EAE mice resulted in a significantly reduced TNFα and IL6 expression in spinal cord, and IL1β expression in brain; while IL1β expression levels in spinal cord, and IL6 levels in brain decreased without reaching significant level (Fig. 5D–F).

Expression levels of inflammatory markers TNFα, IL1β and IL6 in brain and spinal cord from EAE mice, A–C females and D–F males. In females, TNFα, IL1β and IL6 all remarkably reduced in the NT-3 treated cohorts (NT-3) in both brain and spinal cord compared to untreated (UT). In males, expression levels of TNFα and IL6 in spinal cord; and IL1β in brain are significantly reduced (E, F). Data represents Mean ± SEM of mice in each group (female cohort: n = 4 for untreated, n = 4 for treated cohort; male cohort: n = 6 for untreated, n = 7 for treated cohort, student t-test, *p < 0.05).

Full size image

AAV1.NT-3 increases Treg cell population in lymph node and spleen in the EAE mice

Tregs are thought to play a critical role in the maintenance of peripheral immune tolerance. It is believed that Tregs operate by suppressing the effector CD4⁺ T cell subsets that mediate autoimmune responses. Dysregulation of suppressive and migratory markers on Tregs have been linked to the pathogenesis of MS [38]. To investigate whether AAV1.NT-3 treatment increased the percentage of CD3⁺CD4⁺CD25⁺Foxp3⁺ Tregs cells in the EAE mice, we analyzed the cell population from lymph node and spleen by flow cytometry (Figs. 6A, and S4). AAV1.NT-3 treatment in both female and male cohorts significantly increased the percentage of Treg cell population in lymph nodes and spleen compared to samples from untreated counterparts (Fig. 6B, C).

Representative figures of flow cytometry staining CD3⁺CD4⁺CD25⁺ Foxp3⁺ Tregs gated from living lymphocyte or splenocyte and then CD3⁺CD4⁺ cell population (A). Population of Tregs in spleen and lymph nodes from females (B) and from males (C). Data represents Mean ± SEM (female cohort: n = 3 for untreated, and n = 4 for NT-3 treated cohort; male cohort: n = 6 for untreated, and n = 7 for treated cohort). Student t-test, *p < 0.05.

Full size image

AAV1.NT-3 treatment induced dendritic cells ability to suppress immune response

Circulating bone marrow-derived dendritic cells (DCs) are crucial antigen-(Ag-)presenting cells (APCs) that accumulate in the CNS during EAE [39] and are indispensable for disease onset [40]. These migratory cells can present major histocompatibility complex-restricted Ag to CD4⁺ T cells and CD8⁺ T cells (cross presentation) and thus play central roles in priming adaptive immune responses. Therefore, we investigated whether AAV1.NT-3 gene therapy treatment causes DCs to gain a tolerogenic feature. For this, bone marrow DCs were isolated from the femur of AAV1.NT-3 treated and untreated cohorts and the population of DCs were determined by positive signal from DC marker CD11c. We first determined that ~74.1% of the total cells analyzed were positive for CD11c marker (Fig. 7A). To investigate whether AAV1.NT-3 treatment causes DCs to gain ability to suppress immune response, we exposed bone marrow-derived DCs from treated and untreated cohorts to Mycobacteria. DCs from untreated female and male cohorts at 24 h of incubation with Mycobacteria showed significant increase of the proinflammatory marker TNFα expression (Fig. 7B, C). However, this TNFα increase was significantly lower in DCs exposed to Mycobacteria from the AAV1.NT-3 treated cohorts compared with the untreated counterparts indicating that NT-3 has potential to induce ability to suppress immune response. Overall, these results support an immunoregulatory role of NT-3 in favor of tolerogenicity providing neuroprotection and safety measures against the EAE disease process. When DCs were obtained from WT and challenged with mycobacterium, no significant reduction in TNFα levels was observed (Fig. S5), indicating that only in the disease setting NT-3 is exerting this effect.

Dendritic cells (DCs) isolated from bone marrow of female EAE mice (A). Flow cytometry analysis showed 74.1% of total cultured cells expressed DC marker CD11c. DCs from NT-3 treated and untreated EAE female (B) and male mice (C) were challenged with mycobacterium and TNFα level was measured by qPCR. Data represents Mean ± SEM (female cohort: n = 4 for untreated, and n = 4 for NT-3 treated cohort; male cohort: n = 6 for untreated, and n = 7 for NT-3 treated cohort). Student t-test, *p < 0.05.

Full size image

With innovative histopathological and imaging studies, the definition of MS has now evolved as an immune-mediated chronic inflammatory and neurodegenerative disease of the CNS [41, 42]. Data from post-mortem MS tissue and animal models put forward several mechanisms of neurodegeneration including a chronic inflammatory milieu, oxidative stress and dysregulation of the integrated stress response, mitochondrial dysfunction, and impaired remyelination capacity [9, 43,44,45,46]. The primary event in MS is the infiltration of peripheral immune cells that have been primed against components of the myelin sheath leading to the development of focal inflammatory and demyelinating lesions that appear in white matter regions of the brain, optic nerve, and spinal cord. Peripheral immune cells, primarily T and B lymphocytes and macrophages, infiltrate into the CNS parenchyma leading to the formation of perivascular and subependymal/pial demyelination, and neuroaxonal degeneration [47]. Ongoing chronic demyelination and impaired recovery in the CNS is thought to play an important role in perpetuating axonal loss, which is a key component of disease progression leading to permanent disability [44, 48]. It should be noted that with better understanding the disease pathology in MS, the chronic progressive forms whether it is primary or secondary are now considered as part of the same disease spectrum and do not seem different at a pathophysiological level [49]. It was also recognized that pathological mechanisms in progressive MS involve both inflammatory and neurodegenerative components, and that the relative importance of these components may change over the course of the disease [9]. Although inflammation is typically associated with relapses, and neurodegeneration with progression, both pathologies are present in essentially all patients across the entire disease continuum and that neurodegeneration plays a greater role with increasing age and disease duration than focal inflammatory processes. Therefore, developing new treatment strategies, inclusive of the entire spectrum are critical for reducing disease burden.

Although significant progress has been made against relapsing form, the majority of phase II and phase III trials in progressive forms of MS have been negative, emphasizing that the development of highly effective therapies against progressive MS forms remains an unmet need. So far, existing immunomodulatory agents, despite being very efficient in reducing the rate of relapses, do not prevent progressive neurodegenerative processes, while they may cause significant adverse effects [10], thus requiring novel approaches, such as combining anti-inflammatory, immunomodulatory agents with axon neuroprotective or myelin regenerating strategies [50, 51]. The results of our study clearly show that NT-3 is uniquely positioned to accomplish this goal in the EAE mice model of chronic progressive MS. As mentioned earlier, NT-3 is known to exert anti-inflammatory and immunomodulatory effects [17, 18] in addition to its well-recognized properties in the nervous system development, myelination, growth, axonal protection, and regeneration [12,13,14,15, 52]. Specifically, NT-3 stimulates myelin synthesis both in the peripheral nerves as well as in CNS by targeting the translational machinery in oligodendrocytes [27]. Moreover, NT-3 has antioxidant and mitochondria-protective effects. Studies have shown that activated microglia are NT-3-producing cells and express its receptor-TrkC, therefore providing neuroprotection [53], and that pre-treatment of a mouse microglial cell line with NT-3 suppresses LPS-induced proinflammatory agents, nitric oxide (NO), the inducible form of nitric oxide synthase (iNOS), and TNFα, suggesting that NT-3 may serve as an anti-inflammatory factor to suppress microglial activation [54, 55] as we have illustrated in this study. NT3 was also shown to increase the density of axonal mitochondria and decrease their length by inducing mitochondrial fission [56], and improve mitochondria biogenesis and function in aged muscle (sarcopenia), and in the mouse models for Charcot–Marie Tooth subtypes [22, 23, 57]. In addition, NT-3 was shown to be effective in mitigating ER stress by significantly increased Atf4 expression levels in the peripheral nerves from Trembler^J mice [57].

To investigate the potential of AAV1.NT-3 gene therapy in the treatment of chronic progressive MS (primary or secondary), we adopted the EAE mouse model to mimic this clinical course by inducing EAE in C57BL/6 mice [35, 58]. This model can induce an acute phase and then chronic sustained form of EAE, which mimics secondary progressive MS. Like MS patients, the relapsing-remitting course could occur during the chronic phase of EAE. The model also mimics the pathological features of inflammation in CNS, demyelination axonal loss and gliosis [59]. In addition, EAE shares the similarity of immune responses of MS patients by initiating the immune responses from the peripheral autoreactive T cells, which in turn reactive against CNS myelin proteins. In our experiments, we found higher susceptibility in females to EAE than males in BL/6 mice, and this conclusion was not based on one single experiment but driven from repeated observations based on 6 different batches of EAE induction. Similar to our observations, studies have shown higher susceptibility in females to EAE induced in BL/6 mice than males based on greater clinical score and cumulative disease index and with greater splenic and adrenal gland weights than males as well as sex-specific changes in pro- and anti-inflammatory cytokines [37]. In addition, some methodology publications recommend the use of females for EAE induction regardless of the mouse strain [35, 60] and several investigators report using only female BL/6 mice in their experiments [61,62,63,64,65,66], compatible with more consistent results with female BL/6 mice in response to EAE induction. However, there are claims that gender does not influence the susceptibility of C57BL/6 mice to develop chronic EAE induced by MOG [67,68,69].

A major therapeutic goal in MS has been to block destructive immune effector cells while enhancing immunosuppressive regulatory cells. In this study, we applied a gene therapy approach to EAE mouse model of MS via IM delivery of the AAV1.tMCK.NT-3 vector, providing a systemic effect following transduction of muscle to produce NT-3 protein, which is released into serum, as detected by ELISA. This approach unequivocally attenuated the clinical severity, provided histopathological evidence of remyelination supported by increased myelin protein gene expression and axon protection along with decreased astrogliosis and microgliosis. We also show that these functional and histopathological improvements occurred in conjunction with an anti-inflammatory and immunomodulatory environment. Seven weeks following AAV1.NT-3 treatment, there was an increase of Treg cells population in both peripheral lymphocytes and splenocytes from both female and male cohorts. The increased Treg population was associated with suppressed inflammatory status in both spinal cord and brain as the inflammation markers TNFα, IL1β, and IL6 were also significantly decreased or showed a trend in decreasing in treated cohorts. In MS patients, although Th1 and Th17 cells along with their associated cytokines IL-1, IL-6, IL-17, IFNγ and TNFα are increased, no significant difference in the frequency of Tregs were reported comparing to healthy controls [38]. However, Tregs from these patients are reported to have lower suppressive capabilities [70], suggesting that functional deficits in Tregs may contribute to the pathogenesis of MS. In addition, studies suggest that Tregs might be restricted from migrating to neuroinflammatory sites or undergo apoptosis upon arrival [38].

Conceptually, CNS-derived DCs could be linked to Treg-cell expansion, thereby contributing to the resolution of CNS inflammation. DCs can modulate the expansion and function of Treg cells during CNS inflammation. Yet, in MS patients, it has been reported that DCs display an altered phenotype and there is dysfunctional interactions between DCs and Treg cells leading to loss of suppression of effector T cells resulting in myelin destruction, neuronal damage and neuroinflammation [71]. Therefore, regulating the ability of DCs to suppress immune response may be critical in treating MS. In our study, we provided evidence that NT-3 induced DCs ability to suppress an immune response in in vitro assays by isolating DCs from bone marrow and then challenge them using mycobacterium. The TNFα level was significantly suppressed in NT-3 treated DCs compared to untreated ones. Collectively, our study demonstrated the immunomodulatory role of NT-3 to suppress the autoimmune responses in the EAE mice. Yet, further studies are necessary to show the mechanism of how NT-3 regulates Treg cells and DCs.

The possibility of AAV vector itself having an impact on the immune responses might be worrisome for the translational potential of AAV1.NT-3 gene therapy approach in chronic progressive MS. T cell responses to AAV capsid are generally low following IM delivery in animal studies suggesting that cellular immune response to AAV does not lead exclusively to cytotoxicity and gene transfer failure [72]. It has been suggested that several factors can affect the nature of the T cell response, including the AAV serotype, the dose, the administration route, the transgene, and/or the promoter. Interestingly, AAV gene transfer can also result in immune tolerance. Recent studies suggest that the absence of a deleterious T cell response to the AAV1 capsid is mediated by Tregs and exhausted T cells and occurs early after gene transfer to muscle, in both humans and non-human primates without either steroid therapy or any other form of immune modulation [73]. Although in clinical practice, transient corticosteroid-based immunosuppression is being used routinely for efficient management of cytotoxic immune response and ensure gene expression post-vector delivery [74,75,76,77]. Our own experience in human clinical trials using IM delivery of AAV1 carrying the follistatin transgene revealed no adverse events (AEs) or serious AEs related to gene therapy [75, 76]. Assessment of the IFN-Ƴ ELISpot assay for T cell immune responses to the AAV1 capsid showed no consistent pattern of T cell immunity. Subjects in these trials were covered with steroids as a precaution against an immune response to the AAV capsid, especially considering the underlying inflammatory milieu in sporadic inclusion body myositis [75]. These studies suggest an overall well-acceptable safety profile of AAV delivery via IM route.

In summary, our findings demonstrate the translational potential of AAV.NT-3 gene transfer for treatment of chronic progressive MS. Further studies are needed for assessing its efficacy when given during the peak disease activity following EAE induction. Considering the growing interest in understanding the impact of biological aging on MS [78], we believe that AAV.NT-3 gene therapy is well positioned with potential to provide long term efficacy in lowering frequency and severity of relapses. It should also be noted that NT-3 gene therapy should not preclude standard disease-modifying therapies; therefore, can potentially be a component of a combinatorial treatment approach in lowering frequency and severity of relapses, and lowering side-effect profiles of other therapeutic agents.