Ferroptosis enhances the therapeutic potential of oncolytic adenoviruses KD01 against cancer

Introduction

Cancer remains a major global health challenge, driving the need for novel therapeutic strategies. Oncolytic viruses (OVs) have emerged as promising cancer treatments due to their ability to selectively target and lyse tumor cells while inducing anti-tumor immune responses [1, 2]. Numerous OV agents have been developed, and several are currently undergoing clinical trials [3]. Among these, type 5 oncolytic adenovirus (Ad5) stands out for its well-characterized genome, ease of genetic modification, robust transgene expression, and capacity to carry large therapeutic genes [4]. Our team previously developed a recombinant oncolytic adenovirus, KD01, characterized by a 27-base pair deletion in the E1A region (nucleotides 920-946 in Ad5), which enables conditional replication. KD01 also has a deletion in the E3 region, where the ADP gene is replaced with the tBid apoptosis protein gene [5]. This virus has demonstrated potent anti-tumor activity across various tumor models and has been approved by the National Medical Products Administration of China for clinical trials (approval number: CXSL2300531) [5]. However, the therapeutic efficacy of Ad5 is often limited by its reliance on the coxsackievirus and adenovirus receptor (CAR) for cell entry [6], as many tumor cells exhibit low CAR expression, reducing infection efficiency [6,7,8]. To overcome this limitation, strategies such as modifying the viral fiber to alter tropism have been explored. For instance, chimeric Ad5 vectors replace the Ad5 fiber with fibers from other adenovirus serotypes to enhance infection pathways [9]. Additionally, combination therapies have proven effective in improving OV efficacy. For example, combining OVs with immune checkpoint inhibitors, such as PD-L1 blockers, has demonstrated enhanced tumor suppression compared to monotherapies. OBP-702, a conditionally replicating oncolytic adenovirus engineered with modifications in the E1 and E3 regions to selectively replicate in tumor cells and express p53, combined with PD-L1 blockade, significantly inhibited the growth of resistant tumors [6, 10, 11]. while talimogene laherparepvec combined with ipilimumab improved response rates in melanoma patients compared to ipilimumab alone in a phase II trial [12]. Similarly, a randomized phase II study (n = 198) showed that combining ipilimumab with talimogene laherparepvec led to higher objective response rates [13, 14]. OVs combined with chemotherapeutic agents have also been shown to synergistically enhance anti-tumor effects. For example, oAd/DCN/LRP combined with gemcitabine more effectively inhibited pancreatic tumor growth compared to either treatment alone [15]. Moreover, ZD55-TRAIL-IETD-Smac combined with the cyclin-dependent kinase (CDK) inhibitor SNS-032 demonstrated synergistic anti-cancer effects in a phase II clinical trial [16, 17]. Such combination strategies hold significant promise for improving therapeutic outcomes in cancer treatment.

Ferroptosis is a recently identified form of regulated cell death characterized by iron-dependent accumulation of lipid reactive oxygen species (ROS), leading to lethal lipid peroxidation and cell membrane damage [18]. Unlike apoptosis and necrosis, ferroptosis offers a distinct pathway that provides new opportunities for cancer therapy [19]. Inducers of ferroptosis, such as Erastin, have demonstrated potent anti-tumor activity by depleting glutathione and inhibiting the antioxidant ability of cancer cells [20]. Emerging evidence suggests that inducing ferroptosis can enhance the efficacy of oncolytic virotherapy. For example, in oncolytic vaccinia virus, combining with the ferroptosis inducer Erastin produced better therapeutic effects. This was mediated by Erastin activating more dendritic cells and enhancing the activity of tumor-infiltrating T lymphocytes [21]. However, the therapeutic potential of combining ferroptosis inducers with oncolytic adenoviruses remains underexplored.

In this study, a novel therapeutic strategy was developed by combining the ferroptosis inducer Erastin with oncolytic adenovirus to enhance anti-tumor efficacy. The synergistic effects of this combination on cancer cell viability were evaluated both in vitro and in vivo. The results demonstrated that while each monotherapy was beneficial for tumor treatment, the combined therapy produced superior therapeutic outcomes. This provides theoretical support for developing ferroptosis-inducing agents to enhance the efficacy of oncolytic adenovirus.

Materials and methods

Cell culture

The human cancer cell lines utilized in this study, obtained from the Cell Bank of the Chinese Academy of Sciences and maintained in our laboratory, were all STR profiled upon entry into the repository. SK-OV-3 and HEC-1-A cells were cultured in McCoy’s 5A medium (Gibco, USA), A2780 cells in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, USA), and A549, PANC-1, Ishikawa, HeLa, and SiHa cells in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, USA). Each medium was supplemented with 10% fetal bovine serum (FBS, Vazyme, China) and 1% penicillin-streptomycin (Servicebio, China). Cells were incubated at 37 °C in a humidified incubator containing 5% CO2. The culture medium was refreshed every 3–4 days, and cells were subcultured once they reached 80–90% confluence. All procedures were conducted under sterile conditions, and regular mycoplasma testing was performed to ensure the validity of the experimental data.

Preparation of oncolytic adenovirus

The oncolytic adenovirus used in this study, designated KD01, was derived from human adenovirus type 5 through genetic engineering techniques, as previously described [5, 22], and the KD01 used in this study was obtained from the production batch of the oncolytic adenovirus KD01 developed for clinical trials. Viral titers were determined using the Adeno-X Rapid Titer Kit (Takara, Japan) according to the manufacturer’s instructions.

Cell viability assay

Cells were seeded at a density of 5 × 10³ cells per well in 96-well plates. After 24 h of incubation, the cells were exposed to viruses at varying multiplicities of infection (MOIs) or treated with drugs at different concentrations. Following 24, 48 or 72 h of treatment, the culture medium was carefully aspirated, and 90 μL of serum-free medium and 10 μL of CCK-8 reagent (Vazyme, China) were added to each well. The plates were then incubated at 37 °C in a humidified incubator containing 5% CO2 for 1–4 h. Absorbance at 450 nm was measured using a CMax Plus microplate reader (San Jose, USA). Cell viability was calculated as a percentage relative to the untreated control group.

Quantitative real-time PCR (qRT-PCR) assay

After experimental treatments, cells were harvested. Total RNA was extracted using the FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China) according to the manufacturer’s instructions. Reverse transcription was performed with the ABScript Neo RT Master Mix for qPCR with gDNA Remover (ABclonal, China) to synthesize cDNA from the extracted RNA. qRT-PCR reactions were conducted using the BrightCycle Universal SYBR Green qPCR Mix with UDG (ABclonal, China) in a 20 µL reaction volume. The thermal cycling conditions were as follows: 37 °C for 2 min, 95 °C for 3 min, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. GAPDH was used as the internal reference gene. Each reaction was performed in triplicate. The relative gene expression levels were calculated using the 2^−ΔΔCT method.

The specific primer sequences used were:

GPX4: Forward: GAGGCAAGACCGAAGTAAACTAC, Reverse: CCGAACTGGTTACACGGGAA

DKK1: Forward: CCTTGAACTCGGTTCTCAATTCC, Reverse: CAATGGTCTGGTACTTATTCCCG

GAPDH: Forward: GGAGCGAGATCCCTCCAAAAT, Reverse: GGCTGTTGTCATACTTCTCATGG

Western blot assay

After experimental treatments, cells were collected, and total protein was extracted using RIPA lysis buffer (Servicebio, China) supplemented with 1% phenylmethylsulfonyl fluoride (PMSF), phosphatase inhibitors, and protease inhibitor cocktail (Servicebio, China). Protein concentrations were determined using a BCA protein assay kit (Servicebio, China), and samples were adjusted to a final concentration of 1 µg/µL. Equal amounts of protein were separated by SDS-PAGE using a gel preparation kit (Epizyme, China) and then transferred onto polyvinylidene difluoride (PVDF) membranes (Cytiva, USA). Membranes were blocked for 10 minutes with a protein-free blocking solution (Epizyme, China) and incubated overnight at 4 °C with primary antibodies. The following day, membranes were incubated with secondary antibodies for 2 h at room temperature. After washing with TBST, bands were visualized using an enhanced chemiluminescence (ECL) detection reagent (ABclonal, China). Images were captured using the ChemiDoc XRS gel imaging system.

The primary antibodies and their dilution ratios were as follows:

GAPDH: 1:20,000 dilution; Cat# A19056; ABclonal, China

GPX4: 1:500 dilution; Cat# A25009; ABclonal, China

DKK1: 1:1,000 dilution; Cat# A2562; ABclonal, China

The secondary antibody used was:

HRP-conjugated Goat anti-Rabbit IgG (H + L): 1:10,000 dilution; Cat# AS014; ABclonal, China

Flow cytometry assay (MitoSOX, DCFH-DA, and apoptosis assays)

Cells were seeded at a density of 2 × 10⁵ cells per well in 6-well plates. Following treatments with virus, Erastin, or both, cells were harvested. Staining was performed according to the manufacturers’ instructions using MitoSOX™ Red Mitochondrial Superoxide Indicator (RM02822; ABclonal, China), DCFH-DA (HY-D0940; MCE, USA), and FITC Annexin V Apoptosis Detection Kit I (556547; BD Biosciences, USA). Flow cytometric analysis was conducted using a SONY ID7000 flow cytometer (Sony, Japan).

Transmission electron microscopy assay

After experimental treatments, cells were collected by scraping and fixed in electron microscopy fixative solution (Servicebio, China). Fixed cells were sent to Wuhan Servicebio Biotechnology Co., Ltd. for resin embedding and ultrathin sectioning. Ultrathin sections were negatively stained with phosphotungstic acid and examined using a HITACHI HT7800 transmission electron microscope (Hitachi, Japan) at an accelerating voltage of 80 kV.

JC-1 assay

Mitochondrial membrane potential was evaluated using the JC-1 assay with a confocal detection system. SK-OV-3 cells (2 × 10³) were seeded into glass-bottom culture dishes suitable for confocal microscopy (Biosharp, China). After cell adherence, cells were treated with Erastin (10 μM), KD01 (MOI 50), or their combination for 48 h. Cells were then stained with the JC-1 Mitochondrial Membrane Potential Assay Kit (Beyotime, China) according to the manufacturer’s instructions. Fluorescent images were acquired using a laser scanning confocal microscope (Olympus, Japan).

Malondialdehyde (MDA) assay

The intracellular malondialdehyde (MDA) levels were quantified using an MDA Assay Kit (ABclonal, China) following the manufacturer’s protocol. Absorbance was measured at 532 nm using a multifunctional microplate reader (BioTek, USA). The relative MDA content was calculated based on a standard curve generated from known concentrations and normalized to the protein concentration of each sample.

Glutathione (GSH) and oxidized glutathione (GSSG) assay

The levels of glutathione (GSH) and oxidized glutathione (GSSG) were determined using a GSH/GSSG Assay Kit (ABclonal, China) in accordance with the manufacturer’s guidelines. Absorbance was measured at 412 nm using a multifunctional microplate reader (BioTek, USA). The concentrations of GSH and GSSG were calculated from standard curves and normalized to the protein content of each sample.

RNA sequencing and bioinformatics analysis

The total RNA was extracted from SK-OV-3 cells treated with 10 μM Erastin, viral particles at a multiplicity of infection (MOI) of 50 (KD01), or a combination of both for 48 h using TRIzol reagent. RNA samples were stored at −80 °C until analysis. Transcriptome sequencing was performed by Beijing Qingke Biotechnology Co., Ltd. Bioinformatic analyses were conducted using R software. Differential gene expression was analyzed using the edgeR package (Count data), with genes exhibiting a P-value ≤ 0.05 and a log₂fold change (logFC) ≥0.5 considered significantly differentially expressed.

Lentiviral transduction

The SK-OV-3 and A2780 cell lines overexpressing human DKK1 (NCBI accession number NM_012242.4) was established through lentiviral transduction. The lentivirus encoding human DKK1 was purchased from Shanghai GeneChem Co., Ltd. (China). SK-OV-3 cells were seeded in 6 cm culture dishes and infected with the lentivirus at a MOI of 20. Three days post-infection, the medium was replaced with complete medium containing 2 μg/mL puromycin for selection. After 2 days of puromycin selection (during which control cells without resistance markers completely died), single clones were isolated and expanded. The overexpression of DKK1 in selected clones was confirmed by qRT-PCR and Western blot analyses.

Animal model establishment

The female BALB/c-nu mice (4–6 weeks old) were purchased from Jiangsu GemPharmatech Co., Ltd (China). All animal experiments were approved by the Ethics Committee of Tongji Medical College (Approval No. 2022-4147) and conducted in a Specific Pathogen-Free (SPF) facility. SK-OV-3 cells in the logarithmic growth phase were resuspended in phosphate-buffered saline (PBS) at a concentration of 5 × 10⁷ cells/mL. Each mouse was subcutaneously injected with 100 μL of the cell suspension. When tumor volumes reached approximately 100 mm³, mice were randomly divided into four groups (n = 4 per group) and treated according to the experimental protocol. KD01 was administered by intratumoral injection at a dose of 2 × 10⁸ virus particles in 100 μL per injection, once every two days. Additionally, 100 μL of Erastin (20 mg/kg) was administered by intraperitoneal injection every two days for a total of two weeks. Tumor volumes and body weights were recorded every three days. Mice were excluded from the analysis if the subcutaneous xenograft tumors grew larger than 1500 mm³ or if the animals showed signs of distress (e.g., significant weight loss, hunched posture, ruffled fur, lethargy, etc.) that required euthanasia based on ethical guidelines for animal welfare. At the end of the experiment, blood samples, tumors, and major organs were collected for further analysis.

Blood biochemistry and liver and kidney function assay

The blood samples collected from the animals were sent to Wuhan Servicebio Biotechnology Co., Ltd. (China) for biochemical, liver and kidney function analysis. The instruments and assay kits used included the Mindray Fully Automatic Veterinary Hematology Analyzer (Mindray Animal Medical, China), Alanine Aminotransferase (ALT) Assay Kit, Aspartate Aminotransferase (AST) Assay Kit (Leadman, China), Total Bilirubin Assay Kit (Changchun Huili, China), Direct Bilirubin Assay Kit (Changchun Huili, China), Albumin Assay Kit (Leadman, China), Alkaline Phosphatase (ALP) Assay Kit (Leadman, China), Gamma-Glutamyl Transferase (GGT) Assay Kit (Leadman, China), Total Bile Acid Assay Kit (Leadman, China), Urea Assay Kit (Leadman, China), Creatinine Assay Kit (Leadman, China), and Uric Acid Assay Kit (Leadman, China). All tests were performed according to the manufacturers’ instructions to evaluate liver and kidney function parameters.

Hematoxylin and Eosin (H&E) staining

The tissue samples collected from the animals were sent to Wuhan Servicebio Biotechnology Co., Ltd. (China) for histological examination. Briefly, tissues were fixed in 10% neutral-buffered formalin, dehydrated through graded ethanol, cleared in xylene, and embedded in paraffin. Sections of 4 μm thickness were cut using a microtome and mounted on glass slides. After deparaffinization and rehydration, sections were stained with hematoxylin and eosin following standard protocols. Slides were then dehydrated, cleared, and coverslipped. Histological images were captured using a slide scanning system (3D Histech, Hungary).

Immunohistochemistry (IHC)

For immunohistochemical analysis, tissue samples were processed by Wuhan Servicebio Biotechnology Co., Ltd. (China). Tissues were fixed, dehydrated, embedded in paraffin, and sectioned at 4 μm thickness. Sections were deparaffinized, rehydrated, and subjected to antigen retrieval using citrate buffer (pH 6.0) at high temperature. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide. After blocking with normal serum, sections were incubated overnight at 4 °C with a primary antibody against. The next day, sections were incubated with a biotinylated secondary antibody, followed by streptavidin-horseradish peroxidase (HRP) conjugate. Color development was achieved using a DAB substrate kit. Sections were counterstained with hematoxylin, differentiated, dehydrated, and mounted. Images were obtained using a slide scanning system (3D Histech, Hungary).

Statistical analysis

All experiments were conducted in triplicate, and results are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 9.0 (GraphPad Software, USA) and SPSS 22.0 (IBM, USA). The IC₅₀ and HillSlope values were calculated using the normalized response – variable slope model in GraphPad Prism, employing a sigmoidal dose-response curve (four-parameter logistic regression) to estimate drug concentrations required for 50% inhibition. For combination studies, the combination index (CI) was calculated based on the Chou-Talalay method to evaluate synergistic effects, where CI < 1 indicates synergy. Separate IC₅₀ calculations for individual treatments with Erastin or KD01 were performed using SPSS. Statistical significance was assessed using Student’s t test for comparisons between two groups, and one-way or two-way ANOVA followed by post hoc tests for multiple group comparisons. We evaluated the homogeneity of variance among groups using Levene’s test. A p value of less than 0.05 was considered significant.

Result

Erastin enhances the antitumor efficacy of oncolytic adenovirus KD01 in vitro

In our previous studies, we successfully developed a conditionally replicating type 5 oncolytic adenovirus, KD01, which carries the pro-apoptotic gene T-BID. KD01 demonstrated cytotoxic effects across various tumor cell lines; however, its efficacy varied significantly among them. For instance, in the human endometrial adenocarcinoma cell line Ishikawa, the half-maximal inhibitory concentration (IC₅₀) was achieved at a MOI of only 3.5 plaque-forming units (PFU). In contrast, KD01 exhibited substantially lower cytotoxicity against ovarian cancer cell lines SK-OV-3 and A2780, with IC₅₀ MOIs exceeding 100 PFU (Fig. 1A). To enhance KD01’s antitumor efficacy in these less sensitive cell lines, we explored the use of Erastin—a ferroptosis inducer known to potentiate the effects of other oncolytic viruses such as poxvirus, as discussed in the Introduction [21]. We hypothesized that Erastin might similarly enhance the oncolytic activity of KD01.

Initially, SK-OV-3 and A2780 cells were treated with varying concentrations of Erastin to evaluate its cytotoxic effects. Erastin alone induced cell death in both cell lines, with IC₅₀ values of 56.1 μM for SK-OV-3 and 44.1 μM for A2780 (Supplementary Fig. S1). Based on these findings, a sublethal concentration of 10 μM Erastin was selected for combination studies. Subsequently, cells were treated with 10 μM Erastin in combination with KD01 at a MOI of 50 PFU. The combined treatment significantly inhibited cell proliferation compared to either agent alone (Fig. 1B). The combination index (CI) values were 0.405 for SK-OV-3 and 0.204 for A2780, indicating a synergistic effect, as CI values below 1 suggest enhanced efficacy of the combined treatment over single-agent use. Flow cytometry further confirmed increased cytotoxicity in the combination group, as demonstrated by a higher percentage of cell death (Fig. 1C, D). Additionally, morphological changes consistent with increased cell death were observed under optical microscopy (Fig. 1E). These results indicate that Erastin synergistically enhances the antitumor activity of KD01, particularly in tumor cell lines that are otherwise less sensitive to the virus.

Erastin combined with KD01 further induces ferroptosis in tumor cells

Due to the absence of a universally accepted gold standard for detecting ferroptosis, we employed a combination of established assays to determine whether the enhanced antitumor effect observed with Erastin and KD01 co-treatment was mediated through the induction of ferroptosis. Specifically, we utilized transmission electron microscopy (TEM) to observe morphological changes, and various fluorescent probes including DCFH-DA, MitoSOX, and JC-1 to assess intracellular ROS levels, mitochondrial superoxide production, and mitochondrial membrane potential, respectively. Lipid peroxidation was quantified using malondialdehyde (MDA) assays, while the intracellular redox state was evaluated by measuring the GSH/GSSG ratio.

Consistent with characteristics of ferroptosis, TEM images revealed mitochondrial shrinkage and membrane disruption in both the Erastin and Erastin + KD01 treatment groups (Fig. 2A, Supplementary Fig. S2). Flow cytometry analysis using DCFH-DA and MitoSOX probes demonstrated that the combined treatment significantly increased both intracellular and mitochondrial ROS levels compared to single treatments (Fig. 2C–F). This elevation in ROS was accompanied by a significant increase in lipid peroxidation, as evidenced by higher MDA levels (Fig. 2B), and a reduction in the GSH/GSSG ratio (Fig. 2K), indicating oxidative stress and disruption of redox homeostasis. JC-1 staining further confirmed mitochondrial dysfunction, showing a decreased ratio of JC-1 aggregates to monomers, indicative of a loss in mitochondrial membrane potential in the combination treatment group (Fig. 2G, H). Furthermore, Western blot analysis indicated that the expression of GPX4, a critical regulator of ferroptosis, was significantly decreased at both the protein and mRNA levels following Erastin treatment, with an even greater reduction observed in the combination group (Fig. 2I, J). To confirm the role of ferroptosis in the observed antitumor effects, we employed the ferroptosis inhibitor Ferrostatin-1 (Fer-1). Fer-1 not only diminished the antitumor efficacy of Erastin alone but also completely abrogated the enhanced cytotoxicity induced by the Erastin and KD01 combination (Supplementary Fig. S3 and Fig. 2L). Collectively, these results suggest that Erastin enhances the antitumor activity of KD01 by further inducing ferroptosis in tumor cells.

**Fig. 2: Erastin combined with KD01 further induces ferroptosis in tumor cells.**

RNA-Seq identifies DKK1 downregulation as a potential target for enhanced ferroptosis induced by KD01 and Erastin

To further investigate the potential mechanisms underlying the enhanced ferroptosis induced by the combination of KD01 and Erastin, RNA sequencing (RNA-Seq) analysis was performed on SK-OV-3 cells treated with KD01 at a MOI of 50, Erastin at 10 μM, or their combination for 48 h. Principal component analysis (PCA) revealed significant differences in gene expression profiles among the different treatment groups, indicating substantial transcriptional alterations (Fig. 3A).

To identify the pathways through which the combination treatment amplifies ferroptosis, a list of ferroptosis-related genes was downloaded from the FerrDb database. This list included 629 driver genes, 727 suppressor genes, 104 marker genes, and 125 unclassified regulator genes, resulting in 675 unique genes after removing duplicates. Expression levels of these genes were extracted from the RNA-Seq data, and differential expression analysis was conducted. The results showed that, compared to the control group, the combination treatment group had 146 significantly upregulated and 135 significantly downregulated ferroptosis-related genes (Fig. 3B, C). Given the more pronounced ferroptosis observed in the combination group, it was hypothesized that specific gene regulation might contribute to this enhanced effect. An intersection of differentially expressed genes was performed among the Erastin treatment group versus the combination group, the KD01 treatment group versus the combination group, and the control group versus the combination group. This analysis identified 39 intersection genes (Fig. 3D). Notably, among these genes, Dickkopf-1 (DKK1) expression was further decreased in the combination treatment group compared to the single-agent groups, as confirmed by both RNA-Seq data (Fig. 3E) and validation using qRT-PCR and Western blot analyses (Fig. 3F, G). These findings indicate that the combination of KD01 and Erastin may enhance ferroptosis in tumor cells by downregulating DKK1.

The combination treatment exerts its effects through DKK1-mediated ferroptosis

To further investigate whether the enhanced antitumor effect of KD01 and Erastin combination treatment is mediated through the downregulation of DKK1, we established a stable DKK1-overexpressing SK-OV-3 and A2780 ovarian cancer cell line via lentiviral transduction followed by puromycin selection. The overexpression efficiency was confirmed by qRT-PCR and Western blot analyses (Fig. 4A). Using this DKK1-overexpressing cell line, we evaluated the effects of KD01 and Erastin combination treatment. The results showed that overexpression of DKK1 led to a significant reduction in cell death induced by the combination treatment compared to the negative control group (p < 0.01, Fig. 4C). This suggests that restoring DKK1 expression partially inhibited the ferroptosis-promoting effect of the combined treatment. This attenuation was also evident in assays measuring ROS levels. DCFH-DA and MitoSOX probe analyses demonstrated that the elevated intracellular and mitochondrial ROS levels observed with KD01 and Erastin co-treatment were markedly reduced in DKK1-overexpressing cells (Fig. 4B, D). Western blot analysis further confirmed that overexpression of DKK1 mitigated the downregulation of DKK1 protein levels induced by the combination treatment (Fig. 4E). Collectively, these findings suggest that the downregulation of DKK1 is a critical factor in the enhanced ferroptosis induced by KD01 and Erastin combination treatment.

Erastin enhances the in vivo antitumor efficacy of KD01 in mouse models

To evaluate whether Erastin can enhance the antitumor effect of KD01 in vivo, we assessed the combined treatment in an SK-OV-3 subcutaneous xenograft mouse model. The treatment protocol is outlined in Fig. 5A. Throughout the study period, there were no significant changes in body weight among all groups, indicating that the treatments were well-tolerated and did not produce notable toxicity (Fig. 5C). Notably, both Erastin and KD01 monotherapies inhibited tumor growth compared to the control group; however, the combination treatment resulted in a significantly greater suppression of tumor growth (Fig. 5B). At the conclusion of the experiment, tumors were excised and analyzed. Consistent with the observed tumor growth curves, the combination group exhibited substantially smaller tumor volumes and weights than either monotherapy group (Fig. 5D–F). Immunohistochemical staining for Ki67, a marker of cell proliferation, revealed markedly reduced expression in tumors from the combination treatment group, indicating decreased proliferative activity. Additionally, IHC analysis of GPX4 demonstrated that GPX4 expression was significantly reduced in the Erastin-treated group. Importantly, GPX4 expression was further decreased in the combination group, suggesting that the combination treatment may further induce ferroptosis in tumor cells (Fig. 5G and Supplementary Fig. S4). These results demonstrate that Erastin enhances the antitumor efficacy of KD01 in vivo.

Safety evaluation of combined Erastin and KD01 treatment

At the conclusion of the experiment, major organs and blood samples were collected from the mice to assess the safety of the combined treatment. Hematoxylin and eosin (H&E) staining revealed no significant acute or chronic physiological toxicity compared to the control group, as evidenced by the absence of cellular damage, necrosis, or inflammatory responses, indicating good tolerability of the therapy (Fig. 6A). Serum biochemical analyses showed no statistically significant increases in biomarkers related to liver function—including alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), alkaline phosphatase (ALP), total bilirubin (T-BIL), direct bilirubin (DBIL), total bile acid (TBA), and gamma-glutamyl transferase (GGT) or kidney function markers such as urea (UREA), creatinine (CREA), and uric acid (UA), when compared to the control group (Fig. 6B). Routine hematological parameters also remained within normal ranges, suggesting that the combined treatment does not adversely affect hematopoietic function. Furthermore, qRT-PCR analysis detected no expression of the viral Hexon gene in the major organs, indicating that the oncolytic adenovirus KD01 did not disseminate systemically or infect normal tissues. These findings suggest that the combination treatment does not increase off-target effects or toxicity. Collectively, these results underscore that Erastin enhances the antitumor efficacy of KD01 without increasing its off-target effects or toxicity.

Discussion

This study demonstrates that the ferroptosis inducer Erastin significantly enhances the antitumor efficacy of the conditionally replicating oncolytic adenovirus KD01. Our findings suggest that the combination of Erastin and KD01 offers a more effective approach for tumor cell lines with low responsiveness to KD01, potentially providing a new therapeutic direction to improve the efficacy of oncolytic adenovirus therapy. Additionally, we highlight the potential role of DKK1 downregulation in this process, which warrants further investigation.

Previous research established KD01, an oncolytic adenovirus carrying the pro-apoptotic gene tBid, as effective against various tumor cell line [5]. However, its efficacy varies significantly among different cancer types. For instance, KD01 achieved an IC₅₀ at a MOI of only 3.5 plaque-forming units (PFU) in the Ishikawa endometrial adenocarcinoma cell line but required MOIs exceeding 100 PFU to elicit similar effects in ovarian cancer cell lines SK-OV-3 and A2780. This observation aligns with findings from other studies; for example, Kuryk et al. reported that ONCOS-102, an oncolytic adenovirus armed with granulocyte-macrophage colony-stimulating factor (GM-CSF), exhibited suboptimal oncolytic effects in certain ovarian cancer cells [23]. This reduced efficacy may be attributed to the mechanism by which adenovirus serotype 5 (Ad5) enters cells via the CAR. Ovarian cancer cells often exhibit low CAR expression, hindering Ad5 infection [24]. This variability underscores the need for strategies to enhance the antitumor activity of KD01 in Ad5-insensitive cells.

Ferroptosis is a regulated form of cell death characterized by iron-dependent lipid peroxidation and the accumulation of ROS. Since its identification, ferroptosis has garnered attention as a therapeutic target in cancer due to its distinct mechanisms that differ from those of apoptosis and necrosis. Inducing ferroptosis has the potential to overcome resistance that cancer cells often develop against traditional therapies [25, 26]. Erastin, a well-characterized ferroptosis inducer, has been reported to enhance the efficacy of other oncolytic viruses, such as vaccinia virus, by promoting oxidative stress within tumor cells [21]. Based on these insights, we hypothesized that Erastin might similarly augment the oncolytic activity of KD01 in tumors that are insensitive to oncolytic adenoviruses. Our in vitro experiments confirmed that Erastin significantly enhances KD01-induced cytotoxicity in less sensitive tumor cell lines. The combination treatment resulted in greater inhibition of cell proliferation and higher rates of cell death compared to either agent alone, indicating a synergistic effect.

To elucidate the underlying mechanisms, we investigated whether the enhanced antitumor activity was mediated through ferroptosis induction. Multiple assays, including transmission electron microscopy, ROS detection, lipid peroxidation measurements, and mitochondrial function assessments, provided comprehensive evidence that the combination of Erastin and KD01 further induces ferroptosis in tumor cells. Notably, the use of the ferroptosis inhibitor Ferrostatin-1 abrogated the enhanced cytotoxicity, confirming the pivotal role of ferroptosis in the observed effects.

RNA sequencing analysis identified DKK1 as a potential key mediator. DKK1 is a known antagonist of the Wnt/β-catenin signaling pathway and has been implicated in tumor progression, metastasis, and therapy resistance [27, 28]. Our data showed that DKK1 expression was significantly downregulated in the combination treatment group compared to single treatments. Restore expression of DKK1 in SK-OV-3 cells attenuated the enhanced cytotoxicity and ferroptosis induced by the combination therapy, suggesting that downregulation of DKK1 is critical for mediating the enhanced antitumor effects.

DKK1 is a member of the Dickkopf gene family, initially identified by Glinka et al. while investigating factors influencing head development in Xenopus laevis [29]. Subsequent studies have demonstrated that members of the DKK family play crucial roles in vertebrate development, primarily by regulating the WNT signaling pathway [30, 31]. DKK proteins negatively modulate Wnt signaling through competitive binding to low-density lipoprotein receptor-related proteins (LRP), thereby participating in various biological processes [32]. In the context of cancer, the role of DKK1 appears to be dualistic. On one hand, elevated expression of DKK1 has been observed in several cancer types, where it promotes cell proliferation and transformation, thereby facilitating cancer progression [33,34,35]. Conversely, other studies have identified DKK1 as a tumor suppressor [36, 37]. Specifically, in ovarian cancer, cDNA microarray analyses of metastatic epithelial ovarian cancer (EOC) cells have revealed a significant downregulation of DKK1 in metastatic tumors, suggesting that the loss of DKK1 expression may enhance ovarian cancer invasiveness [38]. Supporting this, Duan et al. reported that TET1 exerts antitumor effects in ovarian cancer by activating the Wnt/β-catenin signaling pathway inhibitor DKK1 [39]. Conversely, Wang et al. found that DKK1 mRNA is overexpressed in human ovarian epithelial carcinoma, with patients exhibiting high DKK1 expression showing significantly lower five-year overall survival rates (22.86%) compared to those with low or negative DKK1 expression (47.62%) [40]. These findings indicate that high DKK1 expression is associated with poorer survival outcomes in ovarian cancer, aligning with observations in other cancer types. Therefore, the role of DKK1 in ovarian cancer is complex and warrants further investigation to elucidate its involvement in disease progression.

Recent studies have identified DKK1 as a critical inhibitor of ferroptosis, a form of regulated cell death characterized by iron-dependent lipid peroxidation. DKK1 has been shown to protect cancer cells from ferroptosis [41,42,43]. The underlying mechanism involves upregulation of SLC7A11, a component of the system Xc- responsible for inhibiting ferroptosis [43]. Additionally, by inhibiting the Wnt/β-catenin pathway, DKK1 indirectly reduces STAT3 activity [42], which in turn represses the promoter region of SLC7A11 [41]. These interactions suggest that DKK1 functions as an inhibitor of ferroptosis. In the context of ferroptosis, our study corroborates previous findings. Treatment with Erastin, a ferroptosis inducer, resulted in increased lipid peroxidation and ROS accumulation, thereby promoting ferroptotic cell death. Concurrently, DKK1 expression was downregulated, consistent with its role as a ferroptosis inhibitor. Furthermore, combination therapy led to a further reduction in DKK1 expression, enhancing ferroptosis. Rescue experiments demonstrated that restoring DKK1 expression mitigated the exacerbation of ferroptosis observed with combination treatment. These results suggest that the combined treatment regimen promotes ferroptosis by further downregulating DKK1. The novel interaction between DKK1 and oncolytic adenoviruses observed in this study merits further investigation to elucidate the precise molecular mechanisms involved. Understanding this relationship may provide valuable insights into the modulation of ferroptosis and the development of targeted therapies for ovarian cancer.

Our in vivo studies corroborated the in vitro findings, demonstrating that Erastin enhances the antitumor efficacy of KD01 in a subcutaneous xenograft mouse model. The combination treatment significantly suppressed tumor growth without causing significant toxicity or adverse effects on major organs, as evidenced by histological analyses and serum biochemical assays. Importantly, viral dissemination was not detected in normal tissues, indicating that the oncolytic adenovirus remained localized to the tumor site.

Despite these promising results, several limitations must be acknowledged. First, Erastin is not currently approved for clinical use, and its pharmacokinetic properties and potential toxicity in humans remain concerns. However, clinically approved drugs such as Sorafenib, a multikinase inhibitor used in hepatocellular carcinoma treatment, have been shown to induce ferroptosis and could serve as alternative agents in combination therapies [44, 45]. Utilizing such drugs could expedite the translation of our findings into clinical applications.

Second, our in vivo experiments were conducted in immunodeficient nude mice, which, while commonly used for xenograft studies, do not allow for the evaluation of the immune system’s contribution to antitumor responses. Given that ferroptosis can induce immunogenic cell death through the release of damage-associated molecular patterns (DAMPs) and stimulate antitumor immunity [46, 47], the use of immunocompetent models would be more appropriate to fully assess the therapeutic potential of combination treatments. Although oncolytic adenoviral vectors have been studied in mouse models, the virus exhibits significantly lower replication efficiency in mouse cells compared to human cell lines [48,49,50]. Golden hamsters, on the other hand, permit adenovirus replication more effectively, but their use is limited by the availability of immunological research reagents for studying immune responses [51, 52]. While nude mice were used in our current study, the limitations of these models underscore the importance of future research in immunocompetent systems to better evaluate both the virological and immunological effects of oncolytic therapies.

The controversial aspects of ferroptosis in cancer therapy also warrant consideration. While ferroptosis induction generally suppresses tumor growth and enhances the efficacy of anticancer therapies [53, 54], some studies suggest that cancer cells may develop adaptive resistance mechanisms or that ferroptosis may inadvertently promote tumor metastasis under certain conditions [55]. Therefore, careful optimization and thorough preclinical evaluation are necessary to maximize therapeutic benefits while minimizing potential risks.

Our findings contribute to the growing body of evidence supporting the use of ferroptosis inducers to enhance oncolytic virotherapy. By demonstrating that Erastin enhances KD01 efficacy through DKK1 reduction-mediated ferroptosis, we provide a novel insight into overcoming resistance in oncolytic adenovirus therapy. This approach could be particularly valuable for treating tumors that are refractory to conventional therapies and oncolytic viruses alone.

In conclusion, the combination of Erastin and KD01 represents a promising therapeutic strategy for enhancing antitumor efficacy in resistant cancer cell lines. The downregulation of DKK1 appears to play a critical role in facilitating enhanced ferroptosis and antitumor effects. Future research should focus on validating these findings in immunocompetent animal models, exploring clinically approved ferroptosis inducers, and elucidating the detailed molecular mechanisms underlying DKK1’s role in ferroptosis and oncolytic virus therapy.