The YTHDC1 reader protein recognizes and regulates the lncRNA MEG3 following its METTL3-mediated m6A methylation: a novel mechanism early during radiation-induced liver injury

Introduction

The radiotherapeutic treatment of many tumors in the upper body or other regions in patients with certain cancers can result in the exposure of healthy hepatic tissue to ionizing radiation (IR), leading to the incidence of radiation-induced liver injury (RILI). In the liver, radiation can induce forms of disease such as non-icteric hepatomegaly and ascites that most often manifest within 2 weeks to 3 months post irradiation [1]. Following hepatic radiation at the lowest effective dose (30 Gy), the odds of RILI have been estimated at just 5% [2], yet they rise to >50% at a dose of 40 Gy, and 76% of liver cancer patients who receive a dose of 60 Gy will ultimately succumb to acute liver failure following treatment [3]. At present, the mechanistic basis for RILI has yet to be fully clarified, limiting any efforts to design effective interventional strategies. There is thus a pressing need to clarify the molecular etiology of RILI to guide its prevention and treatment.

RILI incidence is known to be closely associated with apoptotic cell death, oxidative stress, and fibrosis [4], with apoptosis occurring early during RILI [5]. The debris produced through extensive apoptotic cell death, together with inflammatory mediators and oxidative stress, are central to the induction of hepatic fibrosis [6].

It was observed that MEG3 expression was dramatically downregulated in BNL CL2 cells within 24 h following radiation exposure (Fig. 1C). The binding proteins associated with MEG3 were predicted using the RBPDB database (http://rbpdb.ccbr.utoronto.ca/). Analysis revealed multiple binding sites between YTHDC1 and MEG3, suggesting potential methylation modifications of MEG3. Methylation sites of MEG3 were further predicted using the SRAMP tool (https://www.cuilab.cn/sramp). In vitro experiments demonstrated an increase in METTL3 levels post-cell radiation. Additionally, RNAhybrid version 2.2 was employed to predict the sponge targeting sites of MEG3 on miR-20b.

Fig. 1: The impact of irradiation on METTL3, YTHDC1, MEG3, miR-20b, and BNIP2 levels in BNL CL2 cells.
figure 1

A The METTL3 protein level (**p < 0.01) at different time points within 24 h after radiation in BNL CL2 cells. B The YTHDC1 protein level (**p < 0.01) at different time points within 24 h after radiation in BNL CL2 cells. C The MEG3 level (**p < 0.01) at different time points within 24 h after radiation in BNL CL2 cells. D The miR-20b level (**p < 0.01) at different time points within 24 h after radiation in BNL CL2 cells. The BNIP2 mRNA (E) and protein (F) levels (**p < 0.01) at different time points within 24 h after radiation in BNL CL2 cells. AF n = 3. AF were followed by one-way ANOVA.

Full size image

Much like mRNAs, long noncoding RNAs (lncRNAs) can undergo m6A modifications that can modulate their stability, translocation, transcriptional inhibition, and splicing [7, 8]. Methyltransferases (METTL3, METTL14), demethylases (FTO, ALKBH5), and reader proteins (YTHDC1-2, YTHDF1-3) are responsible for shaping the m6A modifications associated with target transcripts [9, 10]. While m6A methylation has been reported to be closely associated with apoptotic cell death [11], the functional role of m6A in the context of RILI pathogenesis remains uncertain, and the involvement of m6A methylation in the control of RILI-associated apoptosis has yet to be assessed.

Here, a significant increase in METTL3-mediated m6A modification levels was observed at 2 h post irradiation, followed 2 days later by a significant reduction in such activity. From a mechanistic perspective, METTL3 was determined to promote the m6A modification of the lncRNA MEG3, resulting in the recruitment of YTHDC1 and the degradation of MEG3, thereby enhancing the ability of miR-20b to inhibit BNIP2 expression. Treatment efforts focused on targeting this m6A modification axis mediated by METTL3 were sufficient to protect against RILI and associated IR-induced apoptotic death, suggesting that efforts to target this YTHDC1/ MEG3 axis may be a feasible means of protecting against RILI.

Methods

Materials

Murine embryonic liver cells (BNL CL2) and Human HEK293T cells were obtained from BNCC Biotech Inc. (BNCC 337873, 353535, Beijing, China). All cells were cultured in DMEM with 10% FBS, penicillin (100 U/mL), and streptomycin (100 U/mL) in a 5% CO2 incubator at 37 °C. Cell lines were cultured in standard conditions, routinely tested for mycoplasma contamination using BeyoDirect™ Mycoplasma qPCR Detection Kit (Beyotime Biotechnology Co., Ltd, Shanghai, China) and authenticated by STR profiling performed by using the PowerPlex® 18D System (Promega DC1802, USA) kit for gene amplification. Cells (1 × 106 cells/mL) in logarithmic growth phase were seeded in plates. Male C57BL/6J mice from Beijing Wei-tong-li-Hua Experimental Animal Technology Co., Ltd. were housed in cages in a climate-controlled facility with a 12 h light/dark cycle. 6- to 8-week-old mice were randomly divided into four groups (n = 8). Investigators were blinded to the group allocation during the experiment. In vivo assays were performed as per the Guide for the Care and Use of Laboratory Animals with approval from the Animal Ethics Committee of Zaozhuang University (Shandong, China). BNIP2 antibody was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA, PA5-101452). YTHDC1, METTL3, α-actinin and GAPDH were purchased from Proteintech Group Inc. (Wuhan, China, 14392-1-AP, 15073-1-AP, 11313-2-AP, 10494-1-AP). Caspase-3/cleaved antibody was purchased from Wan-Lei Biotechnology Co., Ltd (WL02117, Shenyang, China).

Lentiviral injection

A YTHDC1-specific shRNA sequence (TGGATTTGCAGGCGTGAATTA, CGACCAGAAGATTATGATA) was used to establish the GV493 lentiviral vector (hU6-MCS-CBh-gcGFP-IRES-puromycin, GeneChem, Shanghai, China). The YTHDC1 and negative control (NC) shRNA plasmids were packaged in HEK293T cells with a plasmid ratio of pTarget:pVSVg:RRE:REV = 3:1:2:2. After 3 days, viruses secreted from these cells were harvested, centrifuged, filtered, and injected into mice via the tail vein. On days 1 and 4, animals were injected with a total volume of 100 µL. On day 7, samples of liver tissue were collected to assess YTHDC1 protein expression to confirm successful model establishment.

Irradiation

Animals and cells were irradiated at room temperature with a total dose of 6 Gy being provided at an 800 cGy/min dose rate.

Quantitative real-time PCR analysis

TRIzol (Invitrogen) was used for RNA isolation, followed by the analysis of these isolated samples with a Nanodrop 2000C (Thermo Scientific). Then, samples of RNA (2 µg) were reverse transcribed with ReverTra Ace qPCR RT Master Mix Kit (G3322, Wuhan Sevicebio Technology Co., Ltd., Wuhan, China) as directed, while a ring-based method was used to reverse transcribe miRNAs with miRNA RT primers. Thermocycler settings were: 95 °C for 1 min; 40 cycles of 95 °C for 15 s and 60 °C for 30 s; 72 °C for 45 s. Primers used for this study were produced by Wuhan Servicebio Biotechnology Co., Ltd (Wuhan, China) and are presented in Table 1.

Table 1 Oligonucleotides.
Full size table

MeRIP-qPCR analyses

A Ribo MeRIPTM m6A Transcriptome Profiling Kit (R11096.6, Guangzhou Ruibo Biological Technology Co., Ltd. Guangzhou, China) was used to conduct MeRIP-qPCR analyses. Briefly, total RNA was isolated from transfected BNL CL2 cells that had been exposed to X-ray irradiation (6 Gy) at 2 h or 2 days post irradiation with TRIzol. Then, 500 μL of MeRIP reaction solution was combined with anti-m6A magnetic beads for 2 h at 4 °C, followed by the addition of 100 μL of elution buffer to samples after the IP reaction, mixing thoroughly to suspend samples. Samples were then shaken for 1 h at 4 °C, followed by the recovery of the eluted RNA captured with the m6A antibody. Both IP and input samples were analyzed via qPCR.

RIP assay

RIP analyses were conducted using a BersinBioTM RNA Immunoprecipitation (RIP) Kit (Bes5101, Guangzhou Bersinbio Co., Ltd. Guangzhou, China). After harvesting cells and lysing them in a lysis buffer supplemented with RNase and protease inhibitors, these lysates were incubated overnight at 4 °C with anti-YTHDC1 or IgG control. Next, 20 µl of prepared protein A/G magnetic beads were added to these samples followed by a further 1 h incubation at 4 °C. Polysome washing buffer was used to conduct five washes, and RNA attached to these beads was then isolated with TRIzol for subsequent qPCR analyses. When comparing RNA and protein binding, relative enrichment levels were first normalized to input, followed by comparisons with data from samples precipitated using anti-YTHDC1 and anti-IgG.

RNA decay assay

RNA stability was evaluated by transfecting cells with YTHDC1-shRNA and then treating them using actinomycin D (10 μg/mL). After 0, 2, 4, or 8 h, cells were harvested and total RNA was isolated for qPCR-based analyses of relative MEG3 abundance [12].

Statistical analysis

The data are presented as means ± standard deviation (SD) from all experiments. Statistical comparisons between two groups were conducted using a two-tailed Student’s T-test. For analyses involving three or more independent groups, one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test was employed. The outcomes of T-test and one-way ANOVA test encompass the F-test, which assesses the homogeneity of variance. All statistical analyses were performed using GraphPad Prism version 8.2 (GraphPad Software, CA, USA), with a significance threshold set at P < 0.05. Details of number of replicates are provided in the individual figure legends.

Results

YTHDC1-associated m6A methylated proteins and MEG3-related molecules linked to apoptosis are induced following the irradiation of BNL CL2 cells

Predictive analyses of MEG3 identified a putative binding interaction with the target protein YTHDC1, indicating its m6A modification in the context of RILI. Further predictive analyses identified miR-20b as a MEG3 target miRNA, suggesting the ability of MEG3 to serve as a competing endogenous RNA to control BNIP2 expression. METTL3 and YTHDC1 upregulation was evident at 2 h post irradiation relative to the control group (Fig. 1A, B), whereas at later time points after irradiation MEG3 was downregulated (Fig. 1C). The upregulation of miR-20b was observed at 2 h post irradiation (Fig. 1D), while both BNIP2 mRNA and protein levels were reduced within 24 h post irradiation (Fig. 1E, F). Based on these findings, a 2 h time point was selected for downstream analyses.

The m6A reader protein YTHDC1 influences BNL CL2 cell viability and apoptosis following radiation-induced injury

To better understand how YTHDC1 affects post-irradiation apoptotic cell death, YTHDC1 levels were analyzed 1.5 and 2 days after irradiation. At 24 h after irradiation, elevated YTHDC1 levels were evident in BNL CL2 cells(Fig. 1C), whereas it was downregulated significantly at 48 h after irradiation (Fig. 2A). Flow cytometry analyses revealed that the knockdown of YTHDC1 increased apoptotic induction, with higher apoptosis rates in the YTHDC1-knockdown group relative to the NC (negative control) group on day 2 post irradiation (Fig. 2B). When an shRNA vector was used to knockdown YTHDC1, these cells exhibited greater radiation sensitivity as compared to shRNA control cells, with a significant reduction in cellular viability in the irradiated YTHDC1-knockdown group as compared to NC irradiated cells (Fig. 2C). The methylation level of MEG3 detected by MeRIP assay in BNL CL2 cells a at 2 h after 6 Gy radiation was downregulated (Fig. 2D). These findings support that the ability of YTHDC1 to regulate the viability and apoptosis of BNL CL2 cells after irradiation may be related to MEG3 methylation.

Fig. 2: YTHDC1 impacts BNL CL2 cell viability and apoptotic induction following radiation-induced injury.
figure 2

A Western blotting revealed the downregulation of YTHDC1 in BNL CL2 cells on day 2 post irradiation (**P < 0.01). B Flow cytometry was used to examine the impact of YTHDC1 on BNL CL2 cell apoptosis on day 2 post irradiation (**P < 0.01). C. A CCK-8 assay was used to examine the impact of YTHDC1 on BNL CL2 cell viability with or without irradiation (**P < 0.01). D. The methylation level of MEG3 in BNL CL2 cells a at 2 d after 6 Gy radiation was detected by MeRIP assay (**P < 0.01). A, B, D, n = 3; C, n = 5. A, B were followed by one-way ANOVA. C, D were performed by two-tailed unpaired T-test.

Full size image

MEG3 influences BNL CL2 cell viability and apoptosis following radiation-induced injury

To test the impact of MEG3 on post-irradiation apoptosis, this lncRNA was overexpressed. Such MEG3 overexpression increased the rates of cell apoptosis in the absence of irradiation and on day 2 post irradiation (Fig. 3A). Significant MEG3 upregulation was confirmed by qPCR on day 2 post irradiation (Fig. 3B). Cells overexpressing MEG3 exhibited greater radiation sensitivity and significantly reduced viability as compared to NC irradiated cells (Fig. 3C, D). Hoechst staining confirmed higher rates of MEG3-overexpressing cell apoptosis on day 2 post irradiation relative to the radiation-only group (Fig. 3E). These results supported the ability of MEG3 to induce apoptosis and to reduce the viability of irradiated BNL CL2 cells.

Fig. 3: MEG3 influences BNL CL2 cell viability and apoptosis following radiation-induced injury.
figure 3

A Flow cytometry was used to assess the effects of MEG3 on BNL CL2 cell apoptosis on day 2 post irradiation (**P < 0.01). B. MEG3 was significantly upregulated on day 2 post irradiation (**P < 0.01). C A CCK-8 assay was used to assess the impact of MEG3 on BNL CL2 cell viability (**P < 0.01). D A CCK-8 assay was used to assess the impact of MEG3 on BNL CL2 cell viability on day 2 post irradiation (**P < 0.01). E Hoechst staining was used to examine the impact of MEG3 on BNL CL2 cell apoptosis on day 2 post irradiation. A, B n = 3; C, D n = 5; scale bar: 20 µm. A, B were followed by one-way ANOVA. C, D were performed by two-tailed unpaired T-test.

Full size image

METTL3-mediated m6A methylation of MEG3 influences radiation-induced hepatocyte injury

Given the clear roles that YTHDC1 and MEG3 play in the pathogenesis of RILI in vitro, the ability of METTL3 to mediate MEG3 m6A modification was next explored at length. A predictive tool (https://www.cuilab.cn/sramp) was used to identify MEG3 methylation modification sites (Fig. 4A), while a separate database (http://rbpdb.ccbr.utoronto.ca/) identified multiple target binding sites in MEG3 and YTHDC1. The ability of MEG3 and YTHDC1 to interact was initially assessed (3225) (Fig. 4B), and the combination of these results led to the identification of a YTHDC1-dependent methylation modification site (3208) (Fig. 4C). Knockdown of METTL3 in BNL CL2 cells was achieved via lentivirus-mediated shRNA delivery (Fig. 4D), and MEG3 levels were found to be elevated following such METTL3 silencing in the presence or absence of irradiation (Fig. 4E, F). After knocking down METTL3 in BNL CL2 cells, MeRIP assays revealed significant reductions in m6A modification levels in the presence or absence of irradiation (Fig. 4G, H). At 2 h post irradiation, MeRIP assays indicated that MEG3 methylation modification levels were increased (Fig. 4I). An overview of the utilized MeRIP assay approach is shown in Fig. 4J. These results indicated that METTL3-mediated m6A modification can drive the degradation of MEG3, with this process playing a role in hepatocyte injury upon irradiation.

Fig. 4: The m6A methylation of MEG3 mediated by METTL3 plays a role in radiation-induced hepatocyte injury.
figure 4

A Predictive analysis of MEG3-m6A methylation sites. B Predictive analysis of putative binding sites between MEG3 and YTHDC1. C Through the combination of results from (A, B), YTHDC1-dependent methylation sites were identified. D Confirmation of the successful knockdown of METTL3 in BNL CL2 cells (**P < 0.01). qPCR was used to detect levels of MEG3 in cells following METTL3 knockdown without (E) or with (F) 6 Gy irradiation (**P < 0.01). MeRIP was used to detect MEG3 methylation levels in BNL CL2 cells in which METTL3 was knocked down without (G) or with (H) 6 Gy irradiation (**P < 0.01). I MEG3 methylation levels were detected via MeRIP assay in BNL CL2 cells at 2 h following 6 Gy irradiation (**P < 0.01). J Overview of the MeRIP experimental approach. DI n = 3. DI were performed by two-tailed unpaired T-test.

Full size image

METTL3 controls m6A-modified MEG3 expression in a manner dependent on YTHDC1 to regulate radiation-induced hepatocyte injury

Next, experiments were performed to test the ability of YTHDC1 to recognize METTL3-mediated m6A methylation. A lentiviral approach was used to knockdown YTHDC1 in BNL CL2 cells (Fig. 5A), resulting in the upregulation of MEG3 in these cells in the absence or presence of irradiation (Fig. 5B, C). At 2 h post irradiation in METTL3 knockdown cells, a reduction in MEG3 precipitation by YTHDC1 was observed in a RIP assay (Fig. 5D, E). When YTHDC1 was overexpressed in METTL3 knockdown cells, this approach reversed the upregulation of MEG3 induced by knocking down METTL3 (Fig. 5F). RNA was isolated from YTHDC1-knockdown cells at 0, 2, 4, and 8 h following the addition of actinomycin D, revealing lower MEG3 levels in the NC group relative to the YTHDC1-knockdown group, thus demonstrating that YTHDC1 promotes MEG3 degradation (Fig. 5G). MEG3 and YTHDC1 target binding sites are presented in Fig. 5H. The mechanism through which YTHDC1 recognizes METTL3-mediate MEG3 m6A modifications is presented in Fig. 5I. An overview of the utilized RIP approach is presented in Fig. 5J. In summary, METTL3-mediated m6A methylation can promote MEG3 degradation in a YTHDC1 dependent manner after radioactive hepatocyte injury.in a YTHDC1-dependent fashion in the context of radiation-induced hepatocyte injury.

Fig. 5: METTL3 controls MEG3 levels in a YTDC1-dependent fashion in the context of RILI.
figure 5

A Confirmation of the establishment of YTHDC1-knockdown BNL CL2 cells (**P < 0.01). B MEG3 expression in BNL CL2 cells was analyzed via qPCR in YTHDC1 knockdown cells (**P < 0.01). C. MEG3 expression levels were analyzed via qPCR following YTHDC1 knockdown and irradiation in BNL CL2 cells (**P < 0.01). D, E RIP assays were used to pull down MEG3 with anti-YTHDC1 in BNL CL2 cells following METTL3 knockdown and irradiation (**P < 0.01). F MEG3 levels were assessed in cells in which METTL3 had been knocked down and co-transfected with TYHDC1 with or without irradiation (**P < 0.01). G MEG3 levels were detected in NC or YTHDC1 shRNA-treated cells by qPCR following actinomycin D (1 µg/ml) treatment for the indicated periods (**P < 0.01). H MEG3 and YTHDC1 target binding sites. I YTHDC1 can recognize METTL3-mediated MEG3-m6A modification. J RIP experimental overview. AG, n = 3. AG were performed by two-tailed unpaired T-test.

Full size image

MEG3 targets miR-20b to upregulate BNIP2 in BNL CL2 cells, thus shaping radiation-associated damage

The competing endogenous RNA (ceRNA) relationships among MEG3, miR-20b, and BNIP2 were next explored in greater detail. Sites for the adsorption of miR-20b-5p by MEG3 were predicted using RNAhybrid 2.2, and a dual-luciferase reporter assay confirmed significant reductions in luciferase activity in cells transfected with the wild-type MEG3 reporter and miR-20b relative to that in cells transfected with the wild-type MEG3 reporter and miR-NC. In contrast, no significant differences between the miR-20b and miR-NC groups were evident when co-transfected with a mutated version of the MEG3 reporter vector, thus confirming the ability of miR-20b to directly target MEG3. MEG3 can thus function as a molecular sponge to adsorb miR-20b (Fig. 6A). Relative to the NC group, miR-20b levels in the MEG3 group were significantly reduced in the presence or absence of irradiation (Fig. 6B), while the opposite was observed following MEG3 silencing (Fig. 6C), offering further support for the status of miR-20b as a MEG3 target miRNA. BNIP2 mRNA and protein levels were significantly elevated in the MEG3 group in the presence or absence of irradiation (Fig. 6D, E), while knocking down MEG3 had the opposite effect (Fig. 6F–H). In the presence or absence of irradiation, MEG3 was able to reverse miR-20b-mediated decreases in BNIP2 levels, suggesting the miR-20b-dependence of this MEG3-driven upregulation of BNIP2 (Fig. 6I, J). Overall, these findings are consistent with a role for MEG3 as a regulator of BNL CL2 cell radiation-induced damage through its ability to bind miR-20b and upregulate BNIP2.

Fig. 6: MEG3 regulates radiation-induced injury in BNL CL2 cells via regulating the miR-20b-mediated control of BNIP2 expression.
figure 6

A A dual-luciferase reporter assay was used to probe the impact of miR-20b on wild-type or mutant MEG3 reporter activity (**P < 0.01; NS no significance); The effects of irradiation (6 Gy) on miR-20b levels were assessed following the overexpression (B) or knockdown (C) of MEG3 (**P < 0.01). The impact of overexpressing MEG3 on BNIP2 mRNA and protein levels without (D) or with (E) irradiation (**P < 0.01). The impact of knocking down MEG3 on BNIP2 mRNA levels without (F) or with (G) irradiation. H The impact of knocking down MEG3 on BNIP2 protein levels in the presence or absence of irradiation (**P < 0.01, NS, no significance); MEG3 is capable of reversing miR-20b-mediated BNIP2 downregulation in the absence (I) or presence (J) of irradiation (**P < 0.01). BJ n = 3. BG were performed by two-tailed unpaired T-test. HJ were followed by one-way ANOVA.

Full size image

miR-20b protects against radiation-induced BNL CL2 cell injury through the targeted downregulation of BNIP2

TargetScan was utilized to predict the potential of BNIP2 as a target of miR-20b. In a luciferase reporter assay performed with HEK293T cells, miR-20b significantly reduced reporter activity in cells co-transfected with a reporter containing the wild-type version of the predicted BNIP2 relative to miR-NC. In contrast, when this binding sequence was mutated, luciferase activity was comparable in the miR-20b and miR-NC groups (Fig. 7A), confirming the ability of miR-20b to directly target BNIP2. Relative to the NC group, BNIP2 mRNA and protein levels were reduced in the miR-20b treatment group (Fig. 7B), and miR-20b retained its ability to reduce these BNIP2 mRNA and protein levels following irradiation (Fig. 7C). Relative to the NC group, miR-20b inhibition increased BNIP2 mRNA and protein levels irrespective of irradiation status (Fig. 7D). When cell viability was analyzed at 2 days post irradiation following the knockdown of miR-20b, cells in which miR-20b expression was impaired exhibited greater radiation sensitivity (Fig. 7E). Following miR-20b knockdown, higher levels of apoptosis measured via Hoechst staining were observed at 2 days post irradiation relative to control irradiated cells (Fig. 7F). These findings suggest the ability of miR-20b to target BNIP2 and thereby disrupt radiation-induced BNL CL2 injury.

Fig. 7: miR-20b protects against radiation-induced injury in BNL CL2 cells through targeting BNIP2.
figure 7

A A dual-luciferase reporter assay was used to probe the impact of miR-20b on the activity of wild-type or mutant BNIP2 (**P < 0.01; NS, no significance). The impact of overexpressing miR-20b on BNIP2 mRNA and protein levels within BNL CL2 cells without (B) or with (C) irradiation. (**P < 0.01). D The impact of knocking down miR-20b on the mRNA and protein levels of BNIP2 in BNL CL2 cells that were or were not irradiated (**P < 0.01, NS no significance). E A CCK-8 assay was used to assess the effects of miR-20b inhibition on BNL CL2 cell viability following miR-20b inhibition and irradiation (**P < 0.01). F Hoechst staining was used to assess the impact of miR-20b inhibition on BNL CL2 cell apoptosis following irradiation. BD, n = 3; A, E, n = 5; scale bar: 20 µm. BE were performed by two-tailed unpaired T-test. D was also followed by one-way ANOVA.

Full size image

YTHDC1 recognizes m6A-modified MEG3 to influence the pathogenesis of RILI in vivo

YTHDC1 was knocked down in mice to explore its relationship with MEG3 in the context of RILI (Fig. 8A). When hepatic samples were collected from mice in the NC and YTHDC1 knockdown groups, lysates were analyzed via MeRIP-qPCR to detect MEG3 levels. Relative to the NC group, significantly lower MEG3 precipitated by m6A was observed in the YTHDC1 knockdown group without or with radiation (Fig. 8B). Relative to the NC group, significantly lower METTL3 and YTHDC1 protein levels were also observed in the YTHDC1 knockdown group (Fig. 8C, D) irrespective of irradiation status. Following irradiation, a reduction in miR-20b levels was detected in both the NC and YTHDC1sh groups of mice (Fig. 8E). Notably, MEG3 expression was upregulated in irradiated NC mice, whereas it was downregulated in irradiated YTHDC1-knockdown mice (Fig. 8F). Furthermore, an increase in BNIP2 levels was observed across all irradiated groups, irrespective of YTHDC1 knockdown status (Fig. 8G). Following irradiation, there was a significant increase in the levels of cleaved caspase-3 (17kD) proteins in both the NC and YTHDC1 shRNA groups. However, the magnitude of this increase was less pronounced in the YTHDC1 shRNA group compared to the NC group (S-Fig. 1). Compared to the NC group, the NC + 6 Gy group exhibited significantly elevated levels of AST, ALT, LDH, and ALP. In contrast, the YTHDC1 shRNA+6 Gy group demonstrated significant reductions in AST, ALT, and LDH levels relative to the YTHDC1 shRNA group, although the ALP level was significantly increased. Additionally, the NC + 6 Gy group showed significantly higher TP, ALB, and GLB values compared to the NC group (S-Fig. 2). The NC and YTHDC1-knockdown mice were used to establish a RILI model system, with liver tissues from these mice being harvested for H&E staining. Relative to NC controls, YTHDC1-knockdown mice exhibited reduced local integrity, chromatin agglutination/fragmentation, new distribution around the nuclear membrane, and cytoplasmic shrinkage. As compared to the irradiated NC mice (6 Gy), the irradiated YTHDC1 mice exhibited larger cellular spaces, chromatin condensation, nuclear dissolution, and the enlargement of hepato-blood sinuses (Fig. 8H). The TUNEL staining results indicated that, compared to the NC group, the hepatocyte apoptosis levels were significantly elevated in the NC + 6 Gy group of mice. The knockdown of hepatic YTHDC1 resulted in a further increase in hepatocyte apoptosis. Moreover, when the combined effects of YTHDC1 knockdown and radiation exposure were assessed (YTHDC1 shRNA+6 Gy group), there was an even more pronounced increase in hepatocyte apoptosis compared to the levels observed in the NC + 6 Gy group subjected to radiation alone (S-Fig. 3). These results support the ability of YTDC1 to modulate the pathogenesis of RILI through the regulation of MEG3 expression within murine liver tissue. These results indicated that YTDC1 could regulate the methylation of MEG3 in mouse liver tissue, and miR-20b targeted and negatively regulated BNIP2, thereby influencing the pathogenesis of RILI.

Fig. 8: YTHDC1 plays a role in RILI in mice through the identification of m6A-modified MEG3.
figure 8

A Schematic overview of the preparation of a YTHDC1-knockdown mouse model. B Hepatic MEG3 methylation modification levels were measured following YTHDC1 knockdown in mice without or with radiation (**P < 0.01). C The impact of knocking down YTHDC1 on hepatic YTHDC1 protein levels was assessed in mice that were or were not irradiated (**P < 0.01) D The impact of silencing YTHDC1 on the hepatic protein levels of METTL3 was assessed in mice that were or were not irradiated (**P < 0.01); E. The impact of silencing YTHDC1 on the hepatic levels of miR-20b was assessed in mice that were or were not irradiated (**P < 0.01); F The impact of silencing YTHDC1 on the hepatic MEG3 levels was assessed in mice that were or were not irradiated (**P < 0.01); G The effects of silencing YTHDC1 on BNIP2 protein in the liver of mice that were or were not irradiated (**P < 0.01); H Pathological changes in murine liver tissue were assessed via H&E staining following the knockdown of YTHDC1 and irradiation-induced damage. BG n = 8; scale bar: 20 µm. B was performed by two-tailed unpaired T-test. CG were followed by one-way ANOVA.

Full size image

Discussion

Multiple studies have documented important roles for m6A modifications in a range of physiological settings and diseases [13, 14]. Here, a positive correlation between m6A modification and IR-induced apoptotic death was detected, underscoring the ability of this alteration to shape RILI pathogenesis. Specifically, IR exposure was found to induce significant changes in m6A modification patterns and apoptotic cell death early during the onset of RILI in vitro and in vivo. Suppressing the effect of this m6A modification through the knockdown of YTHDC1 was sufficient to enhance IR-driven apoptotic death, while luciferase reporter assays and MeRIP-qPCR were employed to confirm interactions between METTL3 and MEG3. Together, these data clearly reveal the ability of the METTL3-mediated m6A modification of MEG3 to recruit YTHDC1, reducing its expression and thereby resulting in enhanced miR-20b-mediated inhibition of BNIP2.

Radiation can directly impact the structure of RNA, thereby affecting m6A methyltransferase binding and catalytic activity, potentially resulting in marked reductions in m6A methylation levels [15]. Several studies have offered support for the ability of m6A to influence gene expression, ultimately controlling a range of processes including self-renewal, differentiation, apoptosis, and invasivity [16]. METTL3 can suppress autophagic flux and enhance the induction of apoptotic death in cardiomyocytes subjected to hypoxia/reoxygenation through the m6A modification of TFEB and the consequent inhibition of the expression of the key regulator of autophagy-related genes and lysosomal biogenesis [17]. Knocking down METTL3 can significantly lower m6A levels, interfere with cellular growth, and increase the rate of apoptotic death [18]. Here, a previously unreported role for m6A modification in the regulation of RILI was reported. Increases in m6A levels mediated by the upregulation of METTL3 were observed in the context of RILI and found to be closely associated with IR-induced adaptive protection potentially at 2 h post irradiation. Decreases in these m6A levels during the course of RILI were found to be closely associated with IR-induced apoptotic death, potentially as a result of the downregulation of METTL3 on day 2 post irradiation. These findings support a possible role for METTL3-mediated m6A modification in the pathogenesis of RILI. MEG3 was identified as a major target of m6A modification mediated by METTL3 upon irradiation during RILI. MeRIP-qPCR was used to confirm the ability of METTL3 to target MEG3 to undergo m6A modification, and luciferase reporter assays further confirmed this relationship.

RNA-seq analyses indicated that IR treatment reduced MEG3 expression levels, and subsequent predictive analyses identified YTHDC1 as a binding partner for this lncRNA. YTHDC1 is capable of binding to methylated RNA, forming transcriptional aggregates via multivalent interactions with transcriptional activators capable of promoting the activation of transcription. YTHDC1 can additionally bind to RNAs to inhibit transcription or to alter the stability of RNAs subjected to m6A modification [19]. YTHDC1 shRNA has been shown to increase rates of keratinocyte apoptosis and to impair wound healing activity [20]. YTHDC1 silencing can suppress bile duct cancer cell proliferative, migratory, and invasive activity, lead to G2/M cell cycle arrest, and promote apoptotic death [21]. Enriched YTHDC1 was detected on MEG3, and knocking down YTHDC1 increased MEG3 levels within BNL CL2 cells that had been irradiated (RIP). Together, these data support the status of MEG3 as a direct YTHDC1 target.

LncRNAs are vital regulators of radiation-induced damage, cell growth, differentiation, oncogenic progression, and apoptosis [22,23,24,25]. The 1.6 kb lncRNA MEG3 is encoded on chromosome 14q32.3 in humans [26, 27]. Prior reports have established the tumor suppressor-like effects of MEG3 in cancers including glioma, gastric cancer, and melanoma [28, 29]. MEGα a MEG3 subtype that can inhibit cell growth, leading some researchers to posit that MEG3 is an important regulator of cellular proliferation [30]. At 48 h following whole-body irradiation, MEG3 upregulation was detected in murine blood [31]. MEG3 expression has also been shown to activate the pyroptosis of neurons through the NLRP3/caspase-1/GSDMD signaling pathway in a m6A-dependent fashion, thereby resulting in ischemic brain injury [32]. MEG3 m6A modification also facilitated apoptotic cell death, oxidative stress, and mitochondrial dysfunction induced by oxygen-glucose deprivation/reperfusion treatment in HT-22 cells [33]. Here, MEG3 was established as an important target of m6A mediated by METTL3 in the context of RILI. MeRIP-qPCR was initially used to confirm the ability of METTL3 to target MEG3 to undergo m6A modification. Decreased MEG3 levels were observed at 2 h post irradiation, with these decreases being eliminated when METTL3 was knocked down. Luciferase reporter assays also confirmed the interaction between METTL3 and MEG3 in the context of m6A modification.

Through their ability to serve as molecular sponges, lncRNAs have been shown to suppress the activity levels of a range of miRNAs, leading to the posttranscriptional derepression of miRNA targets [34]. Many cancers present with miR-20b upregulation, and it can serve as an oncogenic mediator linked to poor prognostic outcomes in these diseases [35, 36]. Specifically, miR-20b-5p promotes enhanced proliferative, migratory, and invasive activity together with reduced apoptosis [37]. This study is the first report demonstrating the ability of MEG3 to target miR-20b. Another Bcl-2 family proteins regulate apoptosis, and BNIP2/NIP2 is a unique member of this family that harbors a BCH domain (BNip2 and Cdc42GAP Homology) rather than the conserved BH3 domain. The BNIP2 BCH domain is essential for apoptotic cell death, as evidenced by previous studies [38, 39]. BNIP2, a Bcl-2 homology domain-only protein within the Bcl-2 family, is integral to mitochondrion-mediated apoptosis [40]. Furthermore, BNIP2 has been implicated in apoptosis induced by the 1-methyl-4-phenylpyridinium ion [41]. Similarly, BNIP2 has been identified as a proapoptotic factor in the context of estrogen-mediated neuroprotection [42]. This is the first report identifying BNIP2 as a miR-20b target, with the ability of miR-20b to inhibit BNIP2 being attenuated by the overexpression of MEG3 in the context of RILI.

In comparison to the NC group, the NC + 6 Gy group exhibited a significant increase in the levels of AST, ALT, LDH, and ALP [43]. This elevation can be attributed to hepatocyte damage, which causes these cytoplasmic indicators to be released into the bloodstream, thereby increasing their corresponding serum levels. At an advanced stage of liver injury, characterized by extensive hepatocyte death and substantial impairment of their functions, the YTHDC1 shRNA+6 Gy group exhibited a notable reduction in the release of AST, ALT, and LDH compared to the YTHDC1 shRNA group, resulting in significantly decreased serum levels of these enzymes in the YTHDC1 shRNA+6 Gy group, although the ALP levels continued to rise. In comparison to the NC group, the NC + 6 Gy group also exhibited a significant increase in the levels of TP, ALB, and GLB. This elevation can be attributed to the impairment of hepatic synthetic function, which subsequently initiates compensatory mechanisms. Concurrently, hepatic injury is known to induce hemoconcentration, thereby contributing to the elevated levels of TP and ALB [44]. Furthermore, liver damage activates the body’s immune response, leading to an augmented production of immunoglobulins, which in turn results in an increased GLB value.

In conclusion, these results offer new insights into METTL3-mediated YTHDC1-dependent MEG3 m6A modification early during the progression of RILI, ultimately leading to regulations in the miR-20b-mediated inhibition of BNIP2 (Fig. 9). Additional detailed research efforts will be vital to fully elucidate the mechanisms that govern m6A modification patterns in RILI. First, to exert their biological effects, m6A modifications must be selectively recognized by specific interacting proteins [45], and multiple m6A readers may shape these biological processes [46]. Here, only YTHDC1 was analyzed, underscoring the need for studies of future regulatory functions for other reader proteins. Second, the importance of METTL14, WTAP, FTO, and ALKBH5 as regulators of m6A also warrants further study. Third, other candidates beyond MEG3 may play roles in the METTL3-mediated YHTDC1-dependent regulatory pathway elucidated herein, and more studies will be necessary to test this possibility.

Fig. 9
figure 9

YTHDC1-dependent METTL3-mediated m6A modification of MEG3 early during RILI and consequent regulation of the miR-20b-mediated inhibition of BNIP2.

Full size image

Related Articles

Mettl3-m6A-NPY axis governing neuron–microglia interaction regulates sleep amount of mice

Sleep behavior is regulated by diverse mechanisms including genetics, neuromodulation and environmental signals. However, it remains completely unknown regarding the roles of epitranscriptomics in regulating sleep behavior. In the present study, we showed that the deficiency of RNA m6A methyltransferase Mettl3 in excitatory neurons specifically induces microglia activation, neuroinflammation and neuronal loss in thalamus of mice. Mettl3 deficiency remarkably disrupts sleep rhythm and reduces the amount of non-rapid eye movement sleep. We also showed that Mettl3 regulates neuropeptide Y (NPY) via m6A modification and Mettl3 conditional knockout (cKO) mice displayed significantly decreased expression of NPY in thalamus. In addition, the dynamic distribution pattern of NPY is observed during wake-sleep cycle in cKO mice. Ectopic expression of Mettl3 and NPY significantly inhibits microglia activation and neuronal loss in thalamus, and restores the disrupted sleep behavior of cKO mice. Collectively, our study has revealed the critical function of Mettl3-m6A-NPY axis in regulating sleep behavior.

KMT2A regulates the autophagy-GATA4 axis through METTL3-mediated m6A modification of ATG4a to promote NPCs senescence and IVDD progression

Intervertebral disc degeneration (IVDD), a disease associated with ageing, is characterised by a notable increase in senescent nucleus pulposus cells (NPCs) as IVDD progresses. However, the specific mechanisms that regulate the senescence of NPCs remain unknown. In this study, we observed impaired autophagy in IVDD-NPCs, which contributed to the upregulation of NPCs senescence and the senescence-associated secretory phenotype (SASP). The dysregulated SASP disrupted NPCs viability and initiated extracellular matrix degradation. Conversely, the restoration of autophagy reversed the senescence phenotype by inhibiting GATA binding protein 4 (GATA4). Moreover, we made the novel observation that a cross-talk between histone H3 lysine 4 trimethylation (H3K4me3) modification and N6-methyladenosine(m6A)-methylated modification regulates autophagy in IVDD-NPCs. Mechanistically, lysine methyltransferase 2A (KMT2A) promoted the expression of methyltransferase-like 3 (METTL3) through H3K4me3 modification, whereas METTL3-mediated m6A modification reduced the expression of autophagy-associated 4a (ATG4a) by attenuating its RNA stability, leading to autophagy damage in NPCs. Silencing KMT2A and METTL3 enhanced autophagic flux and suppressed SASP expression in IVDD-NPCs. Therefore, targeting the H3K4me3-regulated METTL3/ATG4a/GATA4 axis may represent a promising new therapeutic strategy for IVDD.

Iron homeostasis and ferroptosis in muscle diseases and disorders: mechanisms and therapeutic prospects

The muscular system plays a critical role in the human body by governing skeletal movement, cardiovascular function, and the activities of digestive organs. Additionally, muscle tissues serve an endocrine function by secreting myogenic cytokines, thereby regulating metabolism throughout the entire body. Maintaining muscle function requires iron homeostasis. Recent studies suggest that disruptions in iron metabolism and ferroptosis, a form of iron-dependent cell death, are essential contributors to the progression of a wide range of muscle diseases and disorders, including sarcopenia, cardiomyopathy, and amyotrophic lateral sclerosis. Thus, a comprehensive overview of the mechanisms regulating iron metabolism and ferroptosis in these conditions is crucial for identifying potential therapeutic targets and developing new strategies for disease treatment and/or prevention. This review aims to summarize recent advances in understanding the molecular mechanisms underlying ferroptosis in the context of muscle injury, as well as associated muscle diseases and disorders. Moreover, we discuss potential targets within the ferroptosis pathway and possible strategies for managing muscle disorders. Finally, we shed new light on current limitations and future prospects for therapeutic interventions targeting ferroptosis.

Targeting of TAMs: can we be more clever than cancer cells?

With increasing incidence and geography, cancer is one of the leading causes of death, reduced quality of life and disability worldwide. Principal progress in the development of new anticancer therapies, in improving the efficiency of immunotherapeutic tools, and in the personification of conventional therapies needs to consider cancer-specific and patient-specific programming of innate immunity. Intratumoral TAMs and their precursors, resident macrophages and monocytes, are principal regulators of tumor progression and therapy resistance. Our review summarizes the accumulated evidence for the subpopulations of TAMs and their increasing number of biomarkers, indicating their predictive value for the clinical parameters of carcinogenesis and therapy resistance, with a focus on solid cancers of non-infectious etiology. We present the state-of-the-art knowledge about the tumor-supporting functions of TAMs at all stages of tumor progression and highlight biomarkers, recently identified by single-cell and spatial analytical methods, that discriminate between tumor-promoting and tumor-inhibiting TAMs, where both subtypes express a combination of prototype M1 and M2 genes. Our review focuses on novel mechanisms involved in the crosstalk among epigenetic, signaling, transcriptional and metabolic pathways in TAMs. Particular attention has been given to the recently identified link between cancer cell metabolism and the epigenetic programming of TAMs by histone lactylation, which can be responsible for the unlimited protumoral programming of TAMs. Finally, we explain how TAMs interfere with currently used anticancer therapeutics and summarize the most advanced data from clinical trials, which we divide into four categories: inhibition of TAM survival and differentiation, inhibition of monocyte/TAM recruitment into tumors, functional reprogramming of TAMs, and genetic enhancement of macrophages.

Rapid brain tumor classification from sparse epigenomic data

Although the intraoperative molecular diagnosis of the approximately 100 known brain tumor entities described to date has been a goal of neuropathology for the past decade, achieving this within a clinically relevant timeframe of under 1 h after biopsy collection remains elusive. Advances in third-generation sequencing have brought this goal closer, but established machine learning techniques rely on computationally intensive methods, making them impractical for live diagnostic workflows in clinical applications. Here we present MethyLYZR, a naive Bayesian framework enabling fully tractable, live classification of cancer epigenomes. For evaluation, we used nanopore sequencing to classify over 200 brain tumor samples, including 10 sequenced in a clinical setting next to the operating room, achieving highly accurate results within 15 min of sequencing. MethyLYZR can be run in parallel with an ongoing nanopore experiment with negligible computational overhead. Therefore, the only limiting factors for even faster time to results are DNA extraction time and the nanopore sequencer’s maximum parallel throughput. Although more evidence from prospective studies is needed, our study suggests the potential applicability of MethyLYZR for live molecular classification of nervous system malignancies using nanopore sequencing not only for the neurosurgical intraoperative use case but also for other oncologic indications and the classification of tumors from cell-free DNA in liquid biopsies.

Responses

Your email address will not be published. Required fields are marked *